ID: 936214867

View in Genome Browser
Species Human (GRCh38)
Location 2:110544747-110544769
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 6, 1: 2, 2: 3, 3: 50, 4: 539}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936214863_936214867 8 Left 936214863 2:110544716-110544738 CCCTGGTCTTTGTCAGATAATTT 0: 3
1: 5
2: 1
3: 29
4: 281
Right 936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG 0: 6
1: 2
2: 3
3: 50
4: 539
936214864_936214867 7 Left 936214864 2:110544717-110544739 CCTGGTCTTTGTCAGATAATTTC 0: 3
1: 0
2: 7
3: 28
4: 189
Right 936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG 0: 6
1: 2
2: 3
3: 50
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900531086 1:3153522-3153544 ATCATGTGCTGCAGGAGAAACGG + Intronic
901242300 1:7702625-7702647 TTCTTGTTCTCAAGGAGATGAGG + Intronic
901488437 1:9582082-9582104 TTTTTGTTTTTCAGTAGAGACGG + Intronic
901552459 1:10005731-10005753 TTTTTGTTTTTCAGTAGAGATGG + Intronic
905772514 1:40647490-40647512 TTCTTGTTCTGCAAAATAAAAGG - Intronic
905789300 1:40782029-40782051 CTCTTGTTCTGTAGCAGAAATGG - Intergenic
906034333 1:42741123-42741145 CTCTTGGTCTTCAGGAGTAGGGG + Intergenic
906045344 1:42825817-42825839 TTCTTGTGCGTAAGGAGAAAGGG - Intronic
906235095 1:44201843-44201865 TTCTTTTTCTTTTTGAGAAAGGG - Intergenic
906354306 1:45090815-45090837 TTCTTTTTCTTAAAGAGACAGGG - Intronic
906631742 1:47375586-47375608 AACTTGTTCTTCATGAGAAATGG + Intronic
906813035 1:48848936-48848958 TTCTTCTTATTCAAAAGAAATGG + Intronic
907454091 1:54564231-54564253 TTCTTTTTCTTCTGGAGACAGGG - Intronic
907586954 1:55627592-55627614 GTCTAGTTGCTCAGGAGAAAGGG - Intergenic
908166040 1:61459819-61459841 TTTTTGTTTTTTAGGGGAAAGGG + Intronic
908530145 1:65026518-65026540 TTCCTGTTCTAGAGGAGGAAGGG - Intergenic
910479203 1:87640190-87640212 TTTTTGTACTTTAGTAGAAACGG + Intergenic
910563416 1:88617617-88617639 TTCTTTTTCTTCAGGAGCTTTGG - Intergenic
911023776 1:93415127-93415149 TTTTTGTACTTCAGGCCAAAGGG - Intergenic
912000559 1:104829337-104829359 TTCCAGTTCTTAAGGAGGAATGG - Intergenic
912256452 1:108063791-108063813 TACTTGGTTTTCAGTAGAAAAGG - Intergenic
912705765 1:111910771-111910793 TCTTCGTTCTACAGGAGAAATGG - Intronic
913970304 1:143410054-143410076 TTGTTGTTCTCCAGGAGAACAGG + Intergenic
914064679 1:144235668-144235690 TTGTTGTTCTCCAGGAGAACAGG + Intergenic
914114471 1:144730686-144730708 TTGTTGTTCTCCAGGAGAACAGG - Intergenic
914844395 1:151273791-151273813 TTCTTGTTCTTTAGGGGCGAGGG + Intergenic
915865240 1:159492469-159492491 TTCTTGTCCCTCAGTGGAAAGGG + Intergenic
916675611 1:167062531-167062553 TTCTTGATCCTCAGGAGCAGGGG + Intronic
918493819 1:185111618-185111640 TTTTTGTTCTTTAAGAGACAGGG - Intergenic
918807890 1:189073075-189073097 TCTTTGTTCTGCAGGAAAAAAGG + Intergenic
919726646 1:200888794-200888816 TTCTTGCTAGGCAGGAGAAAGGG - Intergenic
920342079 1:205281623-205281645 CTCCTGCTTTTCAGGAGAAAGGG + Intergenic
920775433 1:208932298-208932320 TTCTTCTTCCTCAGGTGACATGG + Intergenic
920872265 1:209804907-209804929 TTCATTTCTTTCAGGAGAAAGGG - Intronic
921483105 1:215686296-215686318 TACTTGTTATTCAGAAGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922350244 1:224729238-224729260 TTCATATTTTTCAGTAGAAAGGG - Intronic
922847303 1:228697168-228697190 TTCTTGTCTTTCAAGAGACATGG + Intergenic
922970941 1:229737603-229737625 TGCCTGTTCTTTGGGAGAAATGG + Intergenic
922992434 1:229925812-229925834 TTTTTCTTTTTTAGGAGAAAAGG + Intergenic
924018937 1:239760095-239760117 TTTTTTTTTTTCAGTAGAAACGG + Intronic
924264173 1:242264431-242264453 TTTTTCTTCTTCAGGAGGAAGGG + Intronic
924504464 1:244668531-244668553 TTCTAGTTTTTGAGGAGAAATGG + Intronic
924920646 1:248626027-248626049 TTCTTGCTCCTCGGGAGCAAGGG - Intergenic
1063667877 10:8076018-8076040 TCCCTGTTCTTAAGGTGAAAGGG - Intergenic
1064287038 10:14000686-14000708 ATCGTGTTCTCAAGGAGAAAGGG - Intronic
1064399443 10:15009168-15009190 ATCTTTTTCTTCAAGAGAGAAGG - Intergenic
1064906706 10:20355022-20355044 TTTTTGTTTTCCAAGAGAAAGGG - Intergenic
1065398761 10:25271808-25271830 TTTTTTTTCTTTAGTAGAAATGG + Intronic
1065852165 10:29799692-29799714 TTTTTTTTTTTCAGTAGAAACGG - Intergenic
1066254546 10:33665624-33665646 TTCTTTCTCTTCACCAGAAAAGG - Intergenic
1066350212 10:34630453-34630475 TTTTTTTTCTTCCGGAGACAGGG + Intronic
1066551621 10:36564820-36564842 TTCTCTTGCTTCAAGAGAAAAGG + Intergenic
1066720624 10:38334034-38334056 TTTTTCTTCTTCAGGAGGAAGGG - Intergenic
1067118272 10:43452409-43452431 TTCTTCTTTTTCTGGAGACAGGG + Intronic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1067921929 10:50467952-50467974 TTCCTGTTGTCCAGGAGGAATGG + Intronic
1068205095 10:53840066-53840088 TCCTTGTTCTTAAGTACAAAAGG + Intronic
1069102916 10:64346118-64346140 GGCTTTTGCTTCAGGAGAAATGG - Intergenic
1069971362 10:72172514-72172536 TTCTTTTTCTTTTGTAGAAATGG + Intronic
1070324474 10:75378915-75378937 TTCTTGTGGTTCAGGAATAAAGG - Intergenic
1070568007 10:77618583-77618605 TACTGGTTCTTCAGGAGAACAGG + Intronic
1070732373 10:78839695-78839717 TTCTTTTTTTTCAAGAGAAAAGG - Intergenic
1071521559 10:86334537-86334559 TTCTTCTACTTCAGGTAAAAAGG - Intronic
1072120411 10:92401123-92401145 TTTTTGTTTTTCCTGAGAAAGGG + Intergenic
1072157909 10:92740653-92740675 TTTTTTTTTTTCAGTAGAAACGG + Intergenic
1072427306 10:95340730-95340752 TTTTTTTTCTTCAGTAGAGATGG + Intronic
1073092089 10:100950732-100950754 TTCTTTTTCTTCTGGACAACGGG + Exonic
1073394542 10:103207208-103207230 TTCCTGTTCATCTGGGGAAAGGG - Intergenic
1073751230 10:106529023-106529045 TTCTTATATTTCAGAAGAAAAGG + Intergenic
1073762078 10:106640104-106640126 TGCTTTTTCATCTGGAGAAAAGG - Intronic
1074982218 10:118628672-118628694 TTCTACTTCTGAAGGAGAAAGGG + Intergenic
1075207652 10:120461042-120461064 TACTTGCTCTTCTGGAGATAAGG - Intronic
1076653694 10:132007272-132007294 CTCTTGTTCTTCTTGAGACAGGG + Intergenic
1077829915 11:5855846-5855868 TTTTTTTTCTTCAGGAGATTTGG - Intronic
1077836220 11:5930045-5930067 TTCTCTTTCCTCAGGGGAAAGGG - Intronic
1078399413 11:11010832-11010854 TTCTTGGTGTCAAGGAGAAAAGG + Intergenic
1079005130 11:16786188-16786210 TTCATGTCCTCCAGGAGACATGG - Intronic
1079060555 11:17245247-17245269 TTCTTTTTTTTCAGTAGAGACGG + Intronic
1080510503 11:32965115-32965137 TTCTTTTTCTTTATGAGACAGGG + Intronic
1082953207 11:58840143-58840165 GTTTTGTTCCTTAGGAGAAAAGG - Intronic
1084116068 11:67043623-67043645 CTCTGGATCTGCAGGAGAAAAGG - Exonic
1084234009 11:67774637-67774659 TTTTTGTTTTTCAGTAGAGATGG + Intergenic
1084845189 11:71893113-71893135 ATCTTTTTCTTCAAGAGAGAAGG + Intronic
1085059207 11:73429340-73429362 TTCTCCTTTTTCAAGAGAAAAGG + Intronic
1085466684 11:76728745-76728767 TTTTTGTTCTTTAGGAGAGAGGG + Intergenic
1085768873 11:79307745-79307767 TTCTTGTTCTTTTGCAGAGAAGG - Intronic
1085855312 11:80169554-80169576 TGCTAGTTCTACAGGAGATATGG - Intergenic
1087092609 11:94289308-94289330 TTCTTGTTCTTCCCGTGAATGGG - Intergenic
1087964529 11:104396280-104396302 TTTTTCTTCTTCAAGAGAATGGG + Intergenic
1088183691 11:107140298-107140320 TTCTGGTTCTCCAGGGGAAGTGG - Intergenic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1089997707 11:122924720-122924742 TGATTGTTCTTAAGGAGAATGGG - Intronic
1090583749 11:128187809-128187831 TTCTTGTTCTACAGGCCAATAGG + Intergenic
1090963010 11:131573766-131573788 TTCTCACTCTTCAAGAGAAAGGG - Intronic
1091268887 11:134291802-134291824 TTTTTTTTCTTTAGTAGAAACGG - Intronic
1091459699 12:634568-634590 TTCTTTTTCTTCTGCAGTAAAGG + Intronic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1091875608 12:3930778-3930800 AGCTTCTTCTTCAGGAAAAAGGG + Intergenic
1092144588 12:6205735-6205757 TTTGTGTTCTTTAGAAGAAAAGG - Intronic
1092711494 12:11342290-11342312 TTCTAGTCCTCCAGGAGAGAGGG - Intergenic
1093475284 12:19547852-19547874 TTCTGTTGCTTCAGGAAAAAAGG - Intronic
1093906687 12:24701894-24701916 ATCTTACTCTTCAGCAGAAAAGG + Intergenic
1094253359 12:28392846-28392868 TTCTACTTCTTCAGGTCAAAAGG - Intronic
1095553204 12:43469819-43469841 TTGTTGTGCTTTAAGAGAAATGG + Intronic
1095783457 12:46085872-46085894 TTCTTTTTCTTCTGGAGGATGGG + Intergenic
1096046537 12:48567575-48567597 TACTTCTTCTTCAGTAGAGATGG + Intergenic
1096070051 12:48770074-48770096 TTTTTTTTTTTCAGTAGAAAAGG + Intronic
1096417111 12:51424100-51424122 TTCTTTTTCTTGAGGAGAGAGGG + Intronic
1096447891 12:51710650-51710672 TTCTTGTTTTTTTGGAGACAGGG - Intronic
1097102599 12:56600157-56600179 TTCTTGGTCTTGGAGAGAAAGGG - Intronic
1097831114 12:64224704-64224726 TTTTTTTTCTTCAGGAAACAAGG - Intergenic
1098478709 12:70937414-70937436 TGTTTTTTCTTCTGGAGAAAGGG + Intergenic
1099957735 12:89367646-89367668 TTCTTCTTCTTTAAGAGACAGGG - Intergenic
1100572326 12:95854417-95854439 TTCCTGTGCTTCAGGAGAGGAGG - Intergenic
1100831220 12:98517990-98518012 TTTTTTTTCTTTAGTAGAAACGG - Intronic
1101711985 12:107276043-107276065 TACTTGCTGTTCACGAGAAAAGG + Intergenic
1101791454 12:107931312-107931334 TTCTGTTTCTTCATGAGTAATGG + Intergenic
1102452314 12:113051004-113051026 TTCTTCTTTTTCAAGAGACAGGG - Intergenic
1102917666 12:116766800-116766822 TGCTTTGTCTTCAGGAGAAGAGG + Exonic
1102949721 12:117023046-117023068 TTCTTTTTCTTTAACAGAAAAGG - Intronic
1103789605 12:123460165-123460187 TTCTTTTCCTTCAGGAGAGGAGG + Intronic
1104102044 12:125621981-125622003 TCCTGATTCTTCAAGAGAAATGG - Intronic
1104496236 12:129242160-129242182 TTCTTGGACTTCAGAAGAATGGG + Intronic
1104831528 12:131755556-131755578 TTCTTCTCCTACAGGTGAAAGGG + Intronic
1105520291 13:21125122-21125144 TTGTCATTCTTCAGGACAAAGGG - Intergenic
1107780967 13:43901802-43901824 TTTTTTTTTTTCAGGAGTAAAGG + Intergenic
1108274195 13:48791330-48791352 TGCTGGGTCTTCAGGAGAATAGG + Intergenic
1108403321 13:50072035-50072057 TTCTTATTTTCCAGGAGAATAGG - Intergenic
1108682134 13:52789658-52789680 ATTTTTTTCTTCAGGAGGAATGG - Intergenic
1108906577 13:55482347-55482369 TTCTTCCTATTCATGAGAAATGG + Intergenic
1109288664 13:60445306-60445328 TTGTCTTTCATCAGGAGAAATGG + Intronic
1109601110 13:64629741-64629763 CTATTGTTCTTCAGTGGAAAAGG - Intergenic
1109661063 13:65461444-65461466 TTTTTTTTTTTCAGGAAAAATGG - Intergenic
1109762916 13:66853745-66853767 TTTTTTTTTTTCAGGAGACAGGG + Intronic
1110745167 13:79044068-79044090 TTTCTGTTCTTCAGGAGCACAGG + Intergenic
1111826155 13:93270241-93270263 TTTTTTTTTTTAAGGAGAAAAGG - Intronic
1111968189 13:94882216-94882238 GTCATGTTCTAAAGGAGAAAAGG - Intergenic
1112330348 13:98472533-98472555 TTCTTCTACTTCAGGAGAGGAGG + Intronic
1112438315 13:99407527-99407549 TTTTTGTACTTCAGTAGAGATGG + Intergenic
1112650334 13:101389702-101389724 TTCTTGTTGTTCACATGAAATGG - Intronic
1113125389 13:106972632-106972654 CACTTGTTGTTCAGGAAAAAGGG + Intergenic
1113653330 13:112053603-112053625 TTCCAGTCCTTCAGGCGAAAGGG + Intergenic
1114868190 14:26623569-26623591 TGCTTGTTGTTCATAAGAAAGGG - Intergenic
1115074428 14:29369629-29369651 TTTTTGTTTTTCAGTAGAGACGG + Intergenic
1115665256 14:35537873-35537895 TTTTTGTTTTTTAGTAGAAACGG - Intergenic
1115688511 14:35821329-35821351 TTCTTGTTCTAAAGGAAATATGG - Intergenic
1116933638 14:50715195-50715217 TTCTTTTTTTTAAGGAGGAAGGG + Intergenic
1117040732 14:51766761-51766783 TTCCTCATCTTCAGGACAAACGG - Intergenic
1117084907 14:52189837-52189859 ATCTTGTTATCCAGGAAAAAGGG + Intergenic
1117134010 14:52715221-52715243 TTTGTGTTCTTCATGATAAAAGG + Intronic
1117307498 14:54490575-54490597 TCCTTATTCTTAAGGAGAAAGGG + Intergenic
1117950160 14:61074764-61074786 TTCTTATCCTTTTGGAGAAAGGG - Intronic
1118208305 14:63743905-63743927 TTTTTGTATTTCAGTAGAAACGG + Intergenic
1118550421 14:66944043-66944065 ATCTTGTTTTTCTGGAAAAAGGG - Intronic
1119249313 14:73138090-73138112 TTGTTTTTCTTTTGGAGAAAAGG + Intronic
1119872111 14:78026859-78026881 TTCCTGTTATTCTGGAGAATGGG + Intergenic
1120309079 14:82807431-82807453 TTCTTATTTTTCAGGGGAAAAGG + Intergenic
1120689093 14:87572710-87572732 TGCTTGTTCTTCAGGTAATAAGG - Intergenic
1120958654 14:90104958-90104980 TTTTTGTTTTTCAGTAGAGATGG + Intronic
1121029038 14:90642291-90642313 TTCTTTGTCTTCAAGTGAAAAGG - Intronic
1121172881 14:91869127-91869149 TTCCTGTTCTGCAGGAGCACCGG + Intergenic
1121200525 14:92113252-92113274 TTTTTGTTCTTTAGTAGAGATGG + Intergenic
1121406727 14:93723531-93723553 TACTTCTGCTGCAGGAGAAAAGG - Intronic
1121992883 14:98577050-98577072 TTCTTTTTCTTCAGGTAAATTGG + Intergenic
1122128707 14:99592953-99592975 TTCTTAATTTTCTGGAGAAAGGG + Intronic
1122301363 14:100732958-100732980 TTCTGTTTCTTCAGAGGAAAGGG - Intronic
1123759944 15:23424293-23424315 TGCTGGTTCTGCAGGTGAAACGG + Intergenic
1123907145 15:24932402-24932424 TTTTTGTACTTTAGTAGAAACGG + Intronic
1123973333 15:25529076-25529098 AGCTTGATCTTCAGGAAAAATGG + Intergenic
1125143472 15:36438226-36438248 TTATTGTTCACCAGAAGAAAGGG + Intergenic
1125398330 15:39273594-39273616 TTTTTCTTTTTAAGGAGAAATGG - Intergenic
1125442971 15:39722921-39722943 TTTTTTTTCTTCAAGAGACAAGG - Intronic
1125796221 15:42405911-42405933 TTCTTTTTCTGCATAAGAAAAGG - Exonic
1126346948 15:47705675-47705697 TTCCTGTACTTCAGAAGAATTGG - Intronic
1126392646 15:48176639-48176661 CACTTTTTGTTCAGGAGAAAAGG + Intronic
1127145389 15:56018185-56018207 CTCTTGCTCTTCAGGAGAGAAGG - Intergenic
1127409302 15:58689777-58689799 TTCATTTTCTTCAGTAGATAGGG - Intronic
1127731419 15:61805769-61805791 TTATTCCCCTTCAGGAGAAAAGG + Intergenic
1128835881 15:70808719-70808741 TTTTTTTTTTTTAGGAGAAATGG + Intergenic
1128858922 15:71048263-71048285 TTCTTGTTTTTCTGTAGAGATGG + Intronic
1129046881 15:72743408-72743430 TTTTTCTTTTTCAGGAGAGAGGG - Intergenic
1130041291 15:80406904-80406926 ATCTTTTTCTTTGGGAGAAAGGG + Intronic
1131095785 15:89653582-89653604 TTCTTTTTCTTCTTGAGACAGGG + Intronic
1133278271 16:4650934-4650956 TTCTTTTTTTTCAGTAGAGACGG - Intronic
1134160326 16:11882948-11882970 TTCTTTTTCTTTAAGAGATAGGG - Intronic
1134516249 16:14889523-14889545 TTTTTTTTCTTCTGGAGAAAGGG - Intronic
1134592117 16:15463085-15463107 TTTTTTTTCTTCTGGAGACAAGG + Intronic
1134703921 16:16288170-16288192 TTTTGTTTCTTCTGGAGAAAGGG - Intronic
1134963622 16:18423944-18423966 TTTTGTTTCTTCTGGAGAAAGGG + Intronic
1134967917 16:18506543-18506565 TTTTGTTTCTTCTGGAGAAAGGG + Intronic
1135145549 16:19959705-19959727 TCCCTCTTCTTAAGGAGAAAGGG - Intergenic
1136104793 16:28022330-28022352 TTTTTGTTTTTTAGGAGACAAGG + Intronic
1136359028 16:29765773-29765795 TTCCTTTGCTTCAGGAGAAAAGG - Intergenic
1137332447 16:47512320-47512342 TTCTTGGTCTTCAAGCAAAAAGG + Intronic
1137787076 16:51148870-51148892 CTCTTTTTCTTCAGTAGTAATGG - Intronic
1137851713 16:51752298-51752320 TGATTAATCTTCAGGAGAAAGGG - Intergenic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1138625387 16:58247627-58247649 TTTTTGTTTTTCTGTAGAAATGG - Intronic
1139396781 16:66646156-66646178 TTTTTGTTCTTCACCAAAAATGG - Intronic
1139448958 16:67015231-67015253 TTCTGGTTCTTTAAGAGACATGG - Intergenic
1139868835 16:70087012-70087034 TTCTTGTTTTTCTTGAGACAGGG - Intergenic
1140026099 16:71291624-71291646 TTTTTGTTTTTCAGTAGAGACGG - Intergenic
1140637887 16:76938075-76938097 TTCTTTTTCTTTAGTAGAGATGG + Intergenic
1140710021 16:77668992-77669014 TTGTTGTTCAGAAGGAGAAAGGG - Intergenic
1141194811 16:81852444-81852466 TTGTAGTTTTTCAGAAGAAAGGG + Intronic
1142216707 16:88833620-88833642 TTTTTGTTTTTCAGTAGAGATGG + Intronic
1143246986 17:5495249-5495271 TTCTTGTATTTTAGTAGAAACGG - Intergenic
1143394024 17:6577589-6577611 TTTTTGTTCTTCATGAACAAGGG - Intergenic
1143739676 17:8943079-8943101 TTTTTTTTCGTCAGGAGACAGGG + Intronic
1144387913 17:14767048-14767070 TTCTTATTTTTTAGTAGAAACGG - Intergenic
1145720863 17:27071332-27071354 TTCTTGTGCTGTAGCAGAAAAGG - Intergenic
1146015334 17:29228592-29228614 TTCTTGTTTTTCAGTAGAGACGG + Intergenic
1146105537 17:30032477-30032499 CTCTTTTTCTTCTGGAGAATAGG + Intronic
1146237817 17:31184774-31184796 CTCTTTTTCTACAGGAGATAAGG - Intronic
1146782285 17:35685352-35685374 TTCTTGTTCATACGGGGAAAAGG - Intronic
1147221574 17:38935646-38935668 TTATTGTACTTCAGTAGTAAAGG - Intergenic
1147756312 17:42770670-42770692 TTTTTTTTCTTTAAGAGAAAGGG + Intergenic
1148081861 17:44971212-44971234 TTTTTGTTCTTAATGAGACAGGG - Intergenic
1148917954 17:50999767-50999789 CTCTTGTTCTTCAGAAAGAAAGG - Intronic
1148997868 17:51727266-51727288 TTTTAATTCTTCAGGAGGAAAGG + Intronic
1149025480 17:52022528-52022550 TTCTAGTTATTAAGGAGAATAGG - Intronic
1149106526 17:52974065-52974087 TTCTAGTTCTTCATGAGAAATGG + Intergenic
1149217892 17:54379545-54379567 TTCTTTTTTTCCAGGAGAAGAGG - Intergenic
1149877807 17:60255468-60255490 TTTGTGTTTTTCAGTAGAAACGG + Intronic
1151130495 17:71891892-71891914 TTCTTGTTTATCAGGAGATGGGG - Intergenic
1151767730 17:76140798-76140820 TTCCTGCTCTTCGGGAGAAAAGG - Intronic
1152891841 17:82886449-82886471 TTCTTGTTCATCATGAGGAAGGG + Intronic
1153144888 18:2020023-2020045 TTCTTTTTCTTTAGGGGAAACGG + Intergenic
1153235998 18:2988273-2988295 TTTATGCTCTTCAGGAGAAACGG + Intronic
1153571353 18:6476400-6476422 CTCTTGTGCTGCAGGAGATAAGG + Intergenic
1153585153 18:6613383-6613405 TTCTTGTTCTTCAAAACTAATGG + Intergenic
1153786392 18:8538813-8538835 GTTTTGTTATTAAGGAGAAAGGG - Intergenic
1153848898 18:9074573-9074595 TTCTTGTTGTTCAACTGAAAAGG + Intergenic
1155109000 18:22695504-22695526 TTCTTATTCTTCAAAATAAAAGG - Intergenic
1155149236 18:23109736-23109758 TTTTTGTATTTCAGGAGAGATGG - Intergenic
1155826192 18:30446351-30446373 TTATTGTTTTTGAGGATAAAGGG + Intergenic
1156248120 18:35322918-35322940 TCCTTATTCTTAAGGAGAAGGGG - Intergenic
1156987099 18:43361406-43361428 TCCTTATTCTTAAGGAGAAGGGG - Intergenic
1157094824 18:44678882-44678904 TTCTCGTTATTCAAGAGAATTGG - Intergenic
1157313928 18:46572849-46572871 TTTTTGTTTTTCAGTAGAGACGG - Intronic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1157371868 18:47121195-47121217 TGCTTCATCTTCAGGGGAAATGG - Intronic
1158208638 18:55022433-55022455 TTCTTATTCAGCAAGAGAAATGG + Intergenic
1158398234 18:57096500-57096522 TTCTTCTTCTTCTTGAGATAGGG - Intergenic
1158782314 18:60665816-60665838 TTTTTTTTTTTCAGTAGAAATGG - Intergenic
1159114627 18:64100147-64100169 TTTTTTTTCTTCAGGGGAGATGG + Intergenic
1159181797 18:64916853-64916875 TTTTTGTTGTTGAGGGGAAAGGG + Intergenic
1160233587 18:77067819-77067841 TTCTTTTCCTTCTGGAGAGAGGG + Intronic
1161472851 19:4469141-4469163 TTTTTGTTTTTCAGTAGACATGG + Intergenic
1162383104 19:10343619-10343641 TTCTTCTTCTTCCTGAGACAGGG + Intergenic
1162606189 19:11709900-11709922 TTCCTGTACTTCAGGAGCAGTGG - Intergenic
1162976845 19:14211447-14211469 TTTTTTTTTTTCAGTAGAAACGG + Intergenic
1163744760 19:19039139-19039161 TTTTTTTTCTTCTGGAGACATGG + Intronic
1163985943 19:20951704-20951726 TTCTTATTCTTTAATAGAAAAGG - Intergenic
1164467924 19:28503764-28503786 TTCTTTCTAATCAGGAGAAAAGG + Intergenic
1165458956 19:35932942-35932964 TTTTTTTTCTTTAAGAGAAATGG - Intergenic
1166011186 19:39943752-39943774 TCCTTATTCTTAAGGAGCAAAGG + Intergenic
1167410593 19:49341567-49341589 ATCATGTTCCCCAGGAGAAAGGG + Intronic
1167553383 19:50176771-50176793 TTCTTTTTTTTCAGTAGAGATGG + Intergenic
1168556629 19:57348166-57348188 TTTTTGTTCTTTATGAGAGACGG + Intergenic
925684165 2:6454191-6454213 TTGTTGCTTTTCTGGAGAAATGG - Intergenic
926475912 2:13322204-13322226 TTCATGGACATCAGGAGAAAAGG + Intergenic
926565003 2:14459305-14459327 TTCTTTTTCTTTGGGGGAAATGG - Intergenic
926792354 2:16587054-16587076 TACGTTTTCTTCAGGTGAAATGG - Intronic
927457478 2:23267563-23267585 TTCTTATTCTTCAAAAGAAAAGG - Intergenic
927498330 2:23565232-23565254 TTTTTCTTCTTCAGTAGAGATGG + Intronic
929068381 2:38003663-38003685 TTTTTGTTCTTGAAAAGAAAAGG + Intronic
929661368 2:43788624-43788646 TTCTTTTTCTTTCGGAGACAAGG + Intronic
930733193 2:54748392-54748414 TTTTTCTTCTTCAGGCTAAAGGG + Intronic
930999414 2:57762541-57762563 TTTTTGTGTTTCAGTAGAAACGG + Intergenic
931229143 2:60359405-60359427 TTATTTTTCTTCTGAAGAAATGG + Intergenic
931398435 2:61908737-61908759 TTTTTGTTTTTCAGTAGAGACGG + Intronic
931614069 2:64137787-64137809 TCCTTGTTTTTAAGGAAAAAAGG - Intronic
932185367 2:69690774-69690796 CTCTTGTTACTCAGGAGAGATGG - Intronic
932566053 2:72910356-72910378 TTTTTTTTTTTCAGAAGAAAGGG + Intergenic
933289259 2:80419833-80419855 TGCTTGTTGTTCAGGAAAAATGG - Intronic
933386257 2:81614259-81614281 TTCTAGTTGATCAGGAAAAAGGG - Intergenic
933630277 2:84648145-84648167 TTTTTGTTCTAAATGAGAAAAGG + Intronic
933676281 2:85060620-85060642 TTTTTGTTTTTTAGGAGAGACGG + Intergenic
933690182 2:85173578-85173600 TTTTTGTTTTTCAAGAGACAGGG + Intronic
933693660 2:85198852-85198874 TTCTTTTTATTTTGGAGAAAGGG - Intronic
933727322 2:85434281-85434303 TTTATGTTTTTCAAGAGAAAGGG - Intronic
933867674 2:86536897-86536919 TTCTTTTTTTTCAGTAGACAGGG + Intronic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
933932625 2:87169376-87169398 TTTTTGTTTTTCAGTAGATACGG + Intergenic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934086972 2:88517887-88517909 GTTTTGTTCTTCAGGTGAAGGGG + Intergenic
934174998 2:89570978-89571000 TTGTTGTTCTCCAGGAGAACAGG + Intergenic
934285314 2:91645332-91645354 TTGTTGTTCTCCAGGAGAACAGG + Intergenic
934527939 2:95063370-95063392 TTTTTGTTTTTCAAGAGAAGGGG + Intergenic
934863002 2:97780011-97780033 TTTTTGTTTTTTTGGAGAAAAGG - Intronic
935351846 2:102157707-102157729 TTCATATTCTTCTGGAGAAATGG - Exonic
935718393 2:105958897-105958919 TTCTTCTTCTTCTGGATACAGGG + Intergenic
935754868 2:106269319-106269341 TTTTTGTTTTTCAGTAGAAACGG - Intergenic
935772030 2:106434315-106434337 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
935908039 2:107861631-107861653 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
935994447 2:108753862-108753884 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936129830 2:109826738-109826760 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936360485 2:111796066-111796088 TTTTTGTTTTTCAGTAGATACGG - Intronic
936424004 2:112399310-112399332 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936856374 2:116962709-116962731 TTCCTGTTCTGCTGGAGAAAGGG + Intergenic
937509777 2:122582787-122582809 TTCTTGATCTTAGGAAGAAAAGG - Intergenic
938508249 2:131909830-131909852 TTCTTATTTTTCAGCAGAATTGG - Intergenic
940111355 2:150158051-150158073 TTCTTGTTTTTCATTTGAAATGG - Intergenic
940454154 2:153874126-153874148 TTCTTATTCTGCAGGAGACGTGG - Intronic
940905816 2:159168470-159168492 TTTTTGTTTTTTAGTAGAAATGG + Intronic
941301920 2:163813113-163813135 TACTTATTGCTCAGGAGAAATGG + Intergenic
941600673 2:167539945-167539967 CTCTATTCCTTCAGGAGAAAAGG + Intergenic
941842457 2:170101037-170101059 TTTTTGTTATTCAGCACAAAAGG + Intergenic
941888797 2:170556690-170556712 TTTTTGTATTTCAGTAGAAACGG + Intronic
942554009 2:177152421-177152443 ATCTACTTCTACAGGAGAAAAGG + Intergenic
942675119 2:178418322-178418344 TTTTTTTTTTTCAGGAGACAGGG + Intergenic
943053711 2:182948499-182948521 TTCTCATTCTTGAGAAGAAATGG - Intronic
944231802 2:197402505-197402527 TTTTTTTTCTTTAGGAGACAGGG - Intronic
944410138 2:199432586-199432608 TTCTTGTTTTTCAGCTGAAATGG - Intronic
944648476 2:201804466-201804488 TTTTTTTTCTTCCGGAGACAGGG - Intronic
944824945 2:203473341-203473363 TCCTTGCTCTTCAGAAAAAAGGG + Intronic
946377348 2:219320072-219320094 TTCTTTTTCTTCTAGAGACAGGG - Intergenic
947023675 2:225712407-225712429 TTTGTATTCTTCTGGAGAAAAGG + Intergenic
947725831 2:232399765-232399787 TTCTTTTTCTTCCTGAGACAGGG + Intergenic
948834317 2:240617957-240617979 CTCTTCCTCTTCAAGAGAAATGG + Intronic
1168792236 20:586215-586237 TTCTTGTTTTTTAGTAGAGACGG + Intergenic
1169910358 20:10643230-10643252 TTTTTGTTCTGTAAGAGAAAGGG + Intronic
1170152740 20:13242373-13242395 TTTTTATTTTTCAGGAGGAAGGG + Intronic
1170559818 20:17547288-17547310 TTCTTATTCTTAAGGAGACAGGG + Intronic
1170909116 20:20546064-20546086 TTGTTGTTTTTCAAGAGATAGGG - Intronic
1170913583 20:20600122-20600144 TTTTTTTTCTTCAGTAGAGACGG - Intronic
1171355533 20:24543006-24543028 TTCTCCTCCTCCAGGAGAAATGG + Exonic
1172236561 20:33380232-33380254 TTCTTCTTCTTCTTGAGACAGGG + Intronic
1172404095 20:34674933-34674955 TTTTTTTTCTTCAAGAGACAGGG - Intronic
1173585364 20:44178192-44178214 TTTTTGTTTTTCAGGTGAAAAGG - Intronic
1173882714 20:46429628-46429650 TGCTTGTGATTCAGGAGAAGAGG + Intronic
1174103114 20:48142319-48142341 TTTTTGTTCCTCATGAAAAAAGG - Intergenic
1174585827 20:51607446-51607468 TTCTTGTTCTACAGGCAAGAAGG + Intronic
1174740190 20:53005424-53005446 TTCCTGTTCCAGAGGAGAAATGG + Intronic
1174770045 20:53291089-53291111 TTCATGTTCTTGAGGAGACATGG - Intronic
1174810880 20:53644485-53644507 TTTTTGTTTTTCTGGAGACAAGG - Intergenic
1175083785 20:56442724-56442746 CTCTTGTATTTCAAGAGAAAAGG + Intronic
1175522297 20:59609568-59609590 TTCCTGTTCTGCAGGAAAACCGG - Intronic
1176273802 20:64251997-64252019 TTCCTGATCTTAAGGAGAAAGGG + Intergenic
1176785245 21:13248734-13248756 TTCTTATTTTTCAGCAGAACTGG + Intergenic
1177563602 21:22788902-22788924 TTTCTGTACTTCAGGAGCAAGGG + Intergenic
1177581839 21:23033495-23033517 TTCTTCCTCTTCATGAGAATGGG + Intergenic
1177842501 21:26250170-26250192 TTCTTTCTCATCAGGAGCAAAGG - Intergenic
1177983285 21:27942492-27942514 TTCTTATTTTTCAGCAGAACTGG + Intergenic
1178047754 21:28713959-28713981 TACTTGTTCATCAGGAATAATGG + Intergenic
1179481989 21:41684420-41684442 TTTTTGTTCTGCAGGAGAGGGGG + Intergenic
1180208719 21:46280101-46280123 TTCTTCTCCTTCAGGGAAAAGGG + Exonic
1181847563 22:25724301-25724323 TTCTAGATCTCCAGGATAAAGGG + Exonic
1182506004 22:30783076-30783098 TTTTTTTTTTTCTGGAGAAAAGG + Intronic
1182927424 22:34138604-34138626 TTCTAGATCATCAGGAGACAGGG - Intergenic
1183002896 22:34876431-34876453 TTCTTCTTCTGTAGGAGAGATGG - Intergenic
1183111872 22:35655978-35656000 TTCTTGTTAGTGAGGAGACAAGG + Intronic
1183392322 22:37552535-37552557 TTCTTGCTCTCCAGGAGAAAGGG + Intergenic
1183996082 22:41633551-41633573 TTCTTGTTTTTTAGTAGAGATGG + Intronic
1184679967 22:46065802-46065824 TTCTTGTATTTCTGTAGAAAGGG + Intronic
1185089876 22:48760288-48760310 TTCTTCTTCACCAGGAGATAAGG + Intronic
950130068 3:10536531-10536553 TTCTTCTTCTTTTTGAGAAAGGG + Intronic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
950589892 3:13929604-13929626 TTCTTGTCCTTCAGGAAGCAGGG + Intergenic
950623405 3:14225995-14226017 TTCTTATTCTGCAGGAGAGCAGG + Intergenic
950913744 3:16621542-16621564 TTCCTTTACTGCAGGAGAAAGGG + Intronic
951800863 3:26594902-26594924 TTATTGTTCTTCAAAAGAAAGGG - Intergenic
952695460 3:36260490-36260512 TTCTTGTTCTTCTTGTGAATGGG - Intergenic
953172211 3:40517368-40517390 TTTTTTTTTTTCAGGAGAGACGG - Exonic
953649473 3:44788023-44788045 TTTTTGTATTTCAGGAGAGACGG + Intronic
954679673 3:52336545-52336567 TTTTTTTTCTTCCTGAGAAAGGG - Intronic
955789778 3:62576618-62576640 TTTTTTTTTTTCAGTAGAAATGG - Intronic
956148016 3:66211771-66211793 TACTTTTTCTTCAGAAGAGATGG - Intronic
956295504 3:67708754-67708776 TTTTTGTTCTTCAGTACATAGGG - Intergenic
957342497 3:78918948-78918970 TTCTTGTGGTTCTGGAGCAAAGG + Intronic
957970584 3:87376656-87376678 TTCTGGTTCTTCAGTAAAGAAGG + Intergenic
958138652 3:89531644-89531666 TTTTTGTATTTCAGGAGACACGG - Intergenic
959552511 3:107678718-107678740 TTTTTTTTCTTCTTGAGAAACGG - Intronic
959620663 3:108395639-108395661 TTTTTTTTTTTTAGGAGAAAGGG + Intronic
960191606 3:114713224-114713246 TTCATTTTCTTCAGAAGAAAAGG + Intronic
960405369 3:117253128-117253150 TTCTTGGAGTTAAGGAGAAAAGG - Intergenic
960790408 3:121424130-121424152 TTCTTCTTCTGGAGGAGACATGG + Exonic
961067354 3:123886956-123886978 TTCTGGTTCTCAAGGACAAAAGG + Intergenic
962173074 3:133123655-133123677 TCCTTGTTCTTGAGGAGCCATGG + Intronic
962174216 3:133135911-133135933 TTTATGTGCTTCAGGACAAATGG + Intronic
962334898 3:134519302-134519324 TTTTTTTTCTTAAGTAGAAATGG + Intronic
962425355 3:135264606-135264628 TTTTTTTTCTTCTGGTGAAAGGG - Intergenic
963143239 3:141965483-141965505 TTCTTTTTCTTCTTGAGAAAGGG - Intronic
964083586 3:152789527-152789549 TCCTTTTTCTTAAGGAGAAGGGG - Intergenic
965433368 3:168616822-168616844 TTCTCATTCTTCATGAGAAATGG + Intergenic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
966004663 3:174995452-174995474 TGCTTGTTCAATAGGAGAAATGG - Intronic
966180642 3:177185436-177185458 TTTTTGTACTTAAGTAGAAATGG - Intronic
967470101 3:189851388-189851410 TTCTTTTTCTTCAGCAGAGACGG - Intronic
967597216 3:191340840-191340862 TTCTTTTTCTTCTAGAGACAGGG + Intronic
967836992 3:193973146-193973168 TTCTTGTTCTGTAGGATGAAGGG - Intergenic
967856723 3:194123349-194123371 TTCTTCTTTTTCAGGGAAAAGGG - Intergenic
967962112 3:194933755-194933777 TTCTGGTTCTGCAGGAAAACAGG - Intergenic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
969226709 4:5803333-5803355 CTCAAGTTCTTCAGGAGAAGGGG - Intronic
969730023 4:8949294-8949316 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
969789627 4:9483408-9483430 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
970103132 4:12548025-12548047 TTCTTGGTCTTGATGAGGAAGGG - Intergenic
970419968 4:15896812-15896834 TTTTTTTTTTTCAGGAGAAAAGG - Intergenic
970481955 4:16485052-16485074 TTCTTGTTGTTCATATGAAACGG + Intergenic
970533995 4:17010662-17010684 TTCATGTACTTCAAAAGAAATGG - Intergenic
971375686 4:26054037-26054059 TCCATGTGCTGCAGGAGAAATGG - Intergenic
971895192 4:32583851-32583873 TCCTTGTCCTTCAGCAGATAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973155178 4:46942835-46942857 TTCTTAATCTTCAGGTGAATGGG + Intronic
973972023 4:56222770-56222792 TTTTTGTTTTTCAGTAGAGATGG - Intronic
974575372 4:63713658-63713680 TTCTTGCTCTTAAAGAGAGATGG - Intergenic
974655387 4:64812868-64812890 TTTTTTTTTTTCAGTAGAAAAGG + Intergenic
974981452 4:68962358-68962380 TTTTTTTTCTTCAGTAAAAATGG + Intergenic
975039800 4:69731926-69731948 TTCTTAGTCTTATGGAGAAAAGG + Intronic
975138419 4:70896761-70896783 TTTTTGTTCTTGTGGAGATAGGG + Intergenic
975660526 4:76684320-76684342 TTCTTGTCCTTATGGAGACACGG - Intronic
975795101 4:77998593-77998615 TTGTTGTTTTTTAGTAGAAAGGG + Intergenic
975881430 4:78912210-78912232 TGATTCCTCTTCAGGAGAAAAGG + Exonic
976526303 4:86094344-86094366 TTCCTGTTCTTCAGAGGGAAAGG + Intronic
977081443 4:92534130-92534152 TTCTTATTTTTCGGGAGCAAAGG + Intronic
977232233 4:94465579-94465601 TTCTTTTTTTTCAGTAGAGACGG + Intronic
978036010 4:103995766-103995788 TTCTTATTTTTCAGTAAAAATGG - Intergenic
978547386 4:109886265-109886287 TTCTCTTTCTTCTGGACAAATGG + Intergenic
978793370 4:112685273-112685295 TTCTTGGTCTACAGGGTAAATGG + Intergenic
978947865 4:114519658-114519680 TCTTTGTTCCTAAGGAGAAAGGG + Intergenic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979393660 4:120159389-120159411 TACTTTTTCTCCAGGAAAAAGGG - Intergenic
980481498 4:133394292-133394314 TTTTTTTTTTTTAGGAGAAAAGG + Intergenic
980508488 4:133755201-133755223 TTCTTGTTCTTCTGTTGGAAAGG + Intergenic
980922002 4:139095872-139095894 TTTTTGTACTTCAGTAGAGATGG - Intronic
981798514 4:148628363-148628385 GTCTTATTCATCAGGAAAAATGG + Intergenic
982114047 4:152082438-152082460 TTTTTGTACTGCAGGAGGAATGG + Intergenic
982474787 4:155836781-155836803 TTCTATTTCTTCACAAGAAACGG + Exonic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
987394126 5:17405342-17405364 TTCTTGTTCTCCAAGAAATATGG + Intergenic
987520096 5:18970709-18970731 TTTTTCCTCTTCAGGAGAGAGGG - Intergenic
988087846 5:26494963-26494985 TTCTTATTGTTAAGGAGAGAGGG - Intergenic
988728677 5:33948406-33948428 TTCTTGTGTTCCAGGAGAATGGG - Intronic
988931001 5:36035569-36035591 TTCCTGTTCTTCAAGAAAACAGG + Exonic
989201078 5:38764433-38764455 TTCTAGTTCTTCTGGACACATGG + Intergenic
989993234 5:50794651-50794673 TTTTTGCTTTTCAGGAAAAATGG + Intronic
990013688 5:51031345-51031367 TTCTTTTGCTTAAGGAGGAAGGG + Intergenic
990429417 5:55719503-55719525 TTCTTGTTTTTCTTGAGACAGGG + Intronic
991209197 5:64084823-64084845 TCCTTCTTCTTGACGAGAAAGGG - Intergenic
991920056 5:71647795-71647817 TCCTTTTTCTTCAAGAGTAAAGG + Intronic
992752027 5:79870637-79870659 GTCTAGGTCTTCAGGGGAAATGG + Intergenic
993255912 5:85589944-85589966 TTCTTCTTCTTCTGTAGAAAGGG - Intergenic
993846068 5:92945145-92945167 TTTTTCTTTTTCAGGAGGAAGGG - Intergenic
993965672 5:94357307-94357329 TTCATGTAGTGCAGGAGAAAAGG + Intronic
995107139 5:108387520-108387542 TTTTTGTATTTCAGTAGAAACGG - Intergenic
995587026 5:113658857-113658879 TTCTTGTATTTCAAGAGAGATGG - Intergenic
997015836 5:129933916-129933938 TTCTTGATGTTCATGTGAAATGG + Intronic
997124725 5:131214366-131214388 TTTTTTTTCTTCTGGAGATATGG - Intergenic
997241342 5:132310487-132310509 TGCATGGGCTTCAGGAGAAAGGG - Intronic
997608058 5:135191116-135191138 TGCTTGCTCTTTAGGAGCAAAGG + Intronic
998087732 5:139340577-139340599 TTCAAATTTTTCAGGAGAAAAGG + Intergenic
998172902 5:139882890-139882912 TTCTTGTTCCTCAGAAGGAAGGG - Intronic
998558637 5:143150160-143150182 CCTTTGTTCTTCAGGAGAGATGG - Intronic
1000851852 5:166350028-166350050 TTCTTCTTCTTCAAGAAAAAAGG - Intergenic
1002400822 5:178990855-178990877 TCCTTGTTTCTCAGGAAAAACGG + Intronic
1003515748 6:6817217-6817239 TTTTTTTTCTTCAGTAGAGATGG + Intergenic
1003909576 6:10731323-10731345 TTTTTGTTTTTCAAGAGACAAGG + Intergenic
1005193239 6:23252763-23252785 TTCTAGTTATTCTAGAGAAAGGG + Intergenic
1005655442 6:27930685-27930707 TTCTTATTCTTTATGAAAAATGG + Intergenic
1007146722 6:39642188-39642210 TTATTGTTCTTGTGGAGTAATGG - Intronic
1008028196 6:46662955-46662977 CTCTCTTTCTGCAGGAGAAAGGG - Intronic
1009034356 6:58098298-58098320 TTCTTTTTTTTCTGGAGACAGGG - Intergenic
1009209959 6:60850001-60850023 TTCTTTTTTTTCTGGAGACAGGG - Intergenic
1009488953 6:64262910-64262932 TCTTTATTCTTCAGGAAAAAGGG + Intronic
1009561023 6:65243732-65243754 TTCTTATTTTTCTGTAGAAATGG - Intronic
1009729373 6:67579694-67579716 TTCTTGTAATTCATGAGAAGTGG - Intergenic
1010156449 6:72799572-72799594 TTCTTTTTCTTGAGTTGAAATGG - Intronic
1010595531 6:77758425-77758447 CTCTTGTCCTTCAGAAAAAAAGG - Intronic
1012006193 6:93716119-93716141 TTCTTGTGCTTGAGCTGAAATGG - Intergenic
1012847602 6:104410577-104410599 TTCTTTTTTTTTAGTAGAAATGG - Intergenic
1013081879 6:106820448-106820470 TCCTTCTTCTTAAGGAAAAAGGG - Intergenic
1013468248 6:110436452-110436474 TTTTTGTTTTTCTGTAGAAATGG - Intronic
1013661413 6:112300477-112300499 TTCCTGTCCTTGAGGTGAAAAGG + Intergenic
1014919661 6:127198740-127198762 TTCTTGTTGCACATGAGAAATGG - Intergenic
1015871122 6:137777418-137777440 TTTTTTTTCTTCAGTACAAACGG - Intergenic
1015935351 6:138402843-138402865 AGCTTGTCCTTCAAGAGAAATGG - Intergenic
1015986545 6:138889829-138889851 TCCTTGTTCTAAAGGAGTAAAGG - Intronic
1016056056 6:139578845-139578867 ATTTTGTTTTTCAAGAGAAATGG - Intergenic
1016495314 6:144654920-144654942 TTTTTCTTCTTCAGGAAAATGGG - Intronic
1017024457 6:150169045-150169067 TTTTTGTACTTTAGTAGAAATGG + Intronic
1017250348 6:152273690-152273712 TTCTAGTTTTTCAAGAGATAGGG - Intronic
1018231672 6:161681844-161681866 TTCTCGTTCTTCATGCCAAAGGG + Intronic
1018337015 6:162803192-162803214 TAATGGTTATTCAGGAGAAAAGG + Intronic
1018801905 6:167229356-167229378 ATCTTGTTTTTCTGGAAAAAAGG + Intergenic
1019069262 6:169328620-169328642 CTCTTGTTTTCCAGGAGAAGGGG - Intergenic
1020192720 7:6012727-6012749 TTTTTGTGTTTCAGTAGAAATGG + Intronic
1020306982 7:6842980-6843002 TGCTTATTCTAAAGGAGAAAAGG - Intergenic
1021225721 7:18023641-18023663 TTTTTTTTTTTCAGTAGAAACGG - Intergenic
1021453061 7:20799247-20799269 TTCTGGCTCTTCAGGGGAAATGG - Intergenic
1021704123 7:23350123-23350145 TTTTGGTTCTACATGAGAAATGG + Intronic
1021757851 7:23872507-23872529 TTCTTGTTTGTTAAGAGAAAGGG + Intergenic
1022050859 7:26669649-26669671 TTCCTTTTCTGCAGGAGAAAGGG + Exonic
1022132781 7:27419279-27419301 TTCTTGCTTTGCAGGAGACATGG - Intergenic
1022173511 7:27851676-27851698 TTTTTGTTTTTTAGGAGACAAGG - Intronic
1022392059 7:29951633-29951655 TGCCTCTTCCTCAGGAGAAAGGG + Intronic
1022568793 7:31430742-31430764 TTCTTATTCTCCTGGAGAAGTGG + Intergenic
1023186074 7:37534393-37534415 TTGATGGTCTTCACGAGAAAAGG - Intergenic
1023467466 7:40472895-40472917 TTTATGTTACTCAGGAGAAATGG + Intronic
1023892829 7:44405801-44405823 TTCTTTTTCTTTAAGAGACACGG + Intronic
1024149787 7:46559308-46559330 TTCCAGCTCTTGAGGAGAAACGG + Intergenic
1024200918 7:47104555-47104577 GTCTTGTCTATCAGGAGAAAGGG - Intergenic
1025188583 7:56880095-56880117 TTTTTGTACTTCAGTAGAGATGG - Intergenic
1025683347 7:63696826-63696848 TTTTTGTACTTCAGTAGAGACGG + Intergenic
1025982661 7:66419434-66419456 TTCTTTTTCTTTATGAGATAAGG - Intronic
1028803409 7:94995175-94995197 TCATTGTTTTTCAAGAGAAATGG + Intronic
1028838630 7:95401540-95401562 TTCTAGTTCTTCATGTGTAAAGG - Intergenic
1029101521 7:98134758-98134780 TTCTTGGTCTTCATAAGAATTGG + Intronic
1029553999 7:101255051-101255073 TTCTCCTTCTTCTTGAGAAAGGG - Intergenic
1030682505 7:112448945-112448967 TTCTTGTTCTTCAGCCAAACAGG - Intronic
1030953527 7:115822126-115822148 ATTTTGTTATTCAGTAGAAATGG + Intergenic
1031052209 7:116955320-116955342 TTCTTGTAGTTCAGGAGTCAGGG + Intronic
1032571458 7:133004130-133004152 TTTTTGTTTTTCAGTAGAGACGG + Intronic
1032889222 7:136176501-136176523 TTCTGCTTTTTCAGGATAAAAGG - Intergenic
1032904845 7:136352317-136352339 TACCTGTTCTTTTGGAGAAATGG - Intergenic
1035437909 7:158872824-158872846 TTCTTTTTTTTCAGTAGAGATGG - Intronic
1035632443 8:1118571-1118593 TTCTTTTTAATCAGTAGAAATGG + Intergenic
1036152738 8:6313675-6313697 TTTTTGTTTCACAGGAGAAAAGG + Intergenic
1036534814 8:9637626-9637648 TTGTTGCTCTCCTGGAGAAAAGG - Intronic
1037190485 8:16118812-16118834 TTTTTGTTTTTCTGGAGAAGAGG - Intronic
1037702884 8:21290881-21290903 TTTTTTTTCCTCAGGTGAAAAGG + Intergenic
1038041237 8:23725986-23726008 TTTTTGTTTTTCAGTAGAGACGG + Intergenic
1038607441 8:29022409-29022431 TTCTTTTTCTTCTTGAGATAGGG - Intronic
1038801778 8:30755749-30755771 TTTTTTTTTTTCTGGAGAAAGGG - Intronic
1039124233 8:34183020-34183042 TTCTTAGTCTTTAGAAGAAAAGG - Intergenic
1039143017 8:34414431-34414453 TTCTTTTTTTTCAGTAGAGACGG + Intergenic
1039147526 8:34465523-34465545 TTTTTGTTCTTTAGTAGAGACGG + Intergenic
1039163460 8:34649181-34649203 TTCTTTTCATACAGGAGAAAAGG - Intergenic
1039180690 8:34862620-34862642 TTCCTGCTCTTCTGGAGAATGGG + Intergenic
1039663022 8:39487750-39487772 TGCTTGTTCTGCAGAAGGAAGGG - Intergenic
1039703674 8:39986285-39986307 TTTTTGTTTTCCAGGAGAAGCGG - Intronic
1039814487 8:41080959-41080981 TTTTTGTTTTTGAGGAGATAGGG - Intergenic
1041643517 8:60228346-60228368 TACCCATTCTTCAGGAGAAATGG + Intronic
1041789797 8:61681762-61681784 TTTCTGTTCATCAGGAGGAAAGG - Intronic
1041905644 8:63030876-63030898 ATCTTTTTTTTCTGGAGAAAGGG - Intronic
1042829606 8:73012125-73012147 TTGTTGTGTTTCAGGAGATAAGG + Intronic
1042899586 8:73710129-73710151 TTTTTGAGCTTGAGGAGAAACGG - Intronic
1043431039 8:80195512-80195534 TTGTTGTTTTTCATGAGACAGGG + Intronic
1043499807 8:80841794-80841816 TTCTTCTTTTTCTAGAGAAAGGG + Intronic
1044799713 8:95941831-95941853 TTTGTGTTTTTCAGTAGAAACGG + Intergenic
1044836606 8:96301684-96301706 TTTTTGTATTTTAGGAGAAACGG + Intronic
1046448380 8:114356289-114356311 TTGATGTTCTTCAAGAGATAGGG - Intergenic
1046799964 8:118415196-118415218 CTCCTGTCCTTCAGAAGAAAAGG + Intronic
1046973498 8:120248504-120248526 CTCTAGTTGTTCAGCAGAAAGGG + Intronic
1047539822 8:125754020-125754042 TTCATATTCTTCAAGAGAACTGG - Intergenic
1047553938 8:125908507-125908529 TTTATTTTCTTCTGGAGAAAGGG + Intergenic
1047589270 8:126309867-126309889 TTCCTTTTCTTGAGAAGAAAAGG - Intergenic
1047621276 8:126610826-126610848 TTCTTTTTCTTCTTGAGATAGGG + Intergenic
1048114776 8:131509343-131509365 TTCTGCTTGTTGAGGAGAAATGG - Intergenic
1048577590 8:135705402-135705424 TTCTTGTTTTTTAAGAGACAAGG + Intergenic
1050078561 9:1890546-1890568 TTTTTCTTCTTCAGAAGGAAGGG + Intergenic
1051923027 9:22290151-22290173 TACTTGAGCATCAGGAGAAAGGG + Intergenic
1051966671 9:22836349-22836371 TGCTGGTTCTTCAGGGAAAAAGG + Intergenic
1052148689 9:25084058-25084080 TTATTTTTCTTGAAGAGAAAAGG + Intergenic
1052584577 9:30410032-30410054 TTCTTCCACTTCAGGAGAATGGG + Intergenic
1054762994 9:69020130-69020152 TTCTTGCTCTGCTGGAGACATGG - Intergenic
1055350287 9:75379528-75379550 TTTTTGTATTTCAGTAGAAATGG + Intergenic
1056202051 9:84286297-84286319 TTCTTGTTTTTAAAGAGATAGGG + Intronic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1056320012 9:85427122-85427144 TTCGTGTTCTTCATCAGGAAGGG - Intergenic
1056831627 9:89921785-89921807 TACTTGTTCTTCTTGAGAATTGG + Intergenic
1056972138 9:91214372-91214394 TTCTTGCTTTTAAAGAGAAAAGG - Exonic
1057213799 9:93217421-93217443 TTCTGACTCTTCTGGAGAAAAGG - Intronic
1057306315 9:93914196-93914218 TCCTTGTTCTACAGGTGAGAAGG + Intergenic
1057433381 9:95016411-95016433 TTTTTGTTTTTTAGTAGAAATGG + Intronic
1057515548 9:95717399-95717421 TTCTTGTTCTTCATGATATGGGG - Intergenic
1057645460 9:96870430-96870452 TTCTAGTTCTTCAGCAGGAAAGG - Intronic
1058697143 9:107569045-107569067 TCTTTCTTCTCCAGGAGAAAGGG + Intergenic
1058897621 9:109413722-109413744 TCCTGGTTCTTAGGGAGAAAGGG + Intronic
1059125964 9:111685261-111685283 TTCTTTTCCTTGAGCAGAAAGGG - Intergenic
1059713777 9:116894228-116894250 TTCTTGTTCTTCAAAGGAAGTGG + Intronic
1061116246 9:128614419-128614441 TTTTTGTATTTCAGTAGAAACGG - Intronic
1061704091 9:132439243-132439265 GTCTTGTTCTTCAGGACTCAGGG - Intronic
1186630833 X:11346909-11346931 TGTTTGTTTTTCAAGAGAAAAGG - Intronic
1187240970 X:17512848-17512870 GCCTTGTTCAACAGGAGAAAGGG - Intronic
1187336178 X:18383992-18384014 TTTTTGTTTTTCAGGAGAGTAGG + Intergenic
1187455100 X:19434406-19434428 TTTTTTTTTTTAAGGAGAAATGG + Intronic
1188294734 X:28433453-28433475 TTCATGTTCACCAGAAGAAAGGG - Intergenic
1188568328 X:31552177-31552199 TTTTTGTTTTTCTGGAGACAGGG + Intronic
1188574041 X:31624261-31624283 TCCTTGTACTTCAGGATAAGGGG - Intronic
1188625080 X:32274225-32274247 TTCTTGTTCTTCAGTATATGAGG - Intronic
1190121403 X:47662392-47662414 TTCTTGCTCTTCTTGGGAAAAGG - Intergenic
1190599165 X:52071580-52071602 TTCTAGTTACTTAGGAGAAAGGG - Intergenic
1190609659 X:52182493-52182515 TTCTAGTTACTTAGGAGAAAGGG + Intergenic
1193023471 X:76818318-76818340 TTTTTGTTTTTCTGCAGAAATGG - Intergenic
1194039049 X:88917048-88917070 TACCCGTACTTCAGGAGAAAGGG - Intergenic
1194340172 X:92697430-92697452 TACTTGTTCTTCAGGTCAGAAGG + Intergenic
1194665139 X:96669389-96669411 TTCTTGGTTATCAGGAAAAATGG - Intergenic
1195455044 X:105058693-105058715 TCCTTTTTTTTCTGGAGAAAAGG - Intronic
1195721261 X:107871438-107871460 TTCTGGAGCTTCAGGAGATATGG - Intronic
1195889843 X:109680807-109680829 TTATTTTTTTTGAGGAGAAATGG + Intronic
1196991813 X:121337618-121337640 TTCTTATACTACAGGACAAATGG + Intergenic
1197056830 X:122131875-122131897 TTTTCCCTCTTCAGGAGAAAGGG - Intergenic
1199416120 X:147585061-147585083 TTTGTTTTCTTCAGAAGAAAGGG - Intergenic
1199915353 X:152334280-152334302 TTCCTGATCTTAGGGAGAAAGGG - Intronic
1200648544 Y:5814193-5814215 TACTTGTTCTTCAGGTCAGAAGG + Intergenic
1201275917 Y:12298517-12298539 TACTTTTTCTTCAGTAGAAAAGG - Intergenic