ID: 936218689

View in Genome Browser
Species Human (GRCh38)
Location 2:110581776-110581798
Sequence CACTGAACTCAGGTTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936218678_936218689 14 Left 936218678 2:110581739-110581761 CCATCCTGCCCCGCCATTGTGTC No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data
936218677_936218689 20 Left 936218677 2:110581733-110581755 CCAGGGCCATCCTGCCCCGCCAT No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data
936218683_936218689 1 Left 936218683 2:110581752-110581774 CCATTGTGTCCTCACATTCCCCA No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data
936218682_936218689 4 Left 936218682 2:110581749-110581771 CCGCCATTGTGTCCTCACATTCC No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data
936218681_936218689 5 Left 936218681 2:110581748-110581770 CCCGCCATTGTGTCCTCACATTC No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data
936218676_936218689 29 Left 936218676 2:110581724-110581746 CCGCTGGTGCCAGGGCCATCCTG No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data
936218679_936218689 10 Left 936218679 2:110581743-110581765 CCTGCCCCGCCATTGTGTCCTCA No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data
936218680_936218689 6 Left 936218680 2:110581747-110581769 CCCCGCCATTGTGTCCTCACATT No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data
936218684_936218689 -8 Left 936218684 2:110581761-110581783 CCTCACATTCCCCAACACTGAAC No data
Right 936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936218689 Original CRISPR CACTGAACTCAGGTTTCCCC TGG Intergenic
No off target data available for this crispr