ID: 936219115

View in Genome Browser
Species Human (GRCh38)
Location 2:110584459-110584481
Sequence ATGCCCTTCTGGAAAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936219115_936219119 22 Left 936219115 2:110584459-110584481 CCTTCACCTTTCCAGAAGGGCAT No data
Right 936219119 2:110584504-110584526 TTCTCTCCACCACTCTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936219115 Original CRISPR ATGCCCTTCTGGAAAGGTGA AGG (reversed) Intergenic
No off target data available for this crispr