ID: 936220391

View in Genome Browser
Species Human (GRCh38)
Location 2:110598078-110598100
Sequence ATGGGCAAACTGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936220391_936220397 -4 Left 936220391 2:110598078-110598100 CCTTCCTCCATCAGTTTGCCCAT No data
Right 936220397 2:110598097-110598119 CCATCTTTCCCCTCAAGAGTGGG No data
936220391_936220395 -5 Left 936220391 2:110598078-110598100 CCTTCCTCCATCAGTTTGCCCAT No data
Right 936220395 2:110598096-110598118 CCCATCTTTCCCCTCAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936220391 Original CRISPR ATGGGCAAACTGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr