ID: 936220395

View in Genome Browser
Species Human (GRCh38)
Location 2:110598096-110598118
Sequence CCCATCTTTCCCCTCAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936220385_936220395 22 Left 936220385 2:110598051-110598073 CCTGGCCTGCCCACATCTCCTCT No data
Right 936220395 2:110598096-110598118 CCCATCTTTCCCCTCAAGAGTGG No data
936220391_936220395 -5 Left 936220391 2:110598078-110598100 CCTTCCTCCATCAGTTTGCCCAT No data
Right 936220395 2:110598096-110598118 CCCATCTTTCCCCTCAAGAGTGG No data
936220389_936220395 12 Left 936220389 2:110598061-110598083 CCACATCTCCTCTGAGGCCTTCC No data
Right 936220395 2:110598096-110598118 CCCATCTTTCCCCTCAAGAGTGG No data
936220390_936220395 4 Left 936220390 2:110598069-110598091 CCTCTGAGGCCTTCCTCCATCAG No data
Right 936220395 2:110598096-110598118 CCCATCTTTCCCCTCAAGAGTGG No data
936220387_936220395 17 Left 936220387 2:110598056-110598078 CCTGCCCACATCTCCTCTGAGGC No data
Right 936220395 2:110598096-110598118 CCCATCTTTCCCCTCAAGAGTGG No data
936220388_936220395 13 Left 936220388 2:110598060-110598082 CCCACATCTCCTCTGAGGCCTTC No data
Right 936220395 2:110598096-110598118 CCCATCTTTCCCCTCAAGAGTGG No data
936220392_936220395 -9 Left 936220392 2:110598082-110598104 CCTCCATCAGTTTGCCCATCTTT No data
Right 936220395 2:110598096-110598118 CCCATCTTTCCCCTCAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936220395 Original CRISPR CCCATCTTTCCCCTCAAGAG TGG Intergenic
No off target data available for this crispr