ID: 936220397

View in Genome Browser
Species Human (GRCh38)
Location 2:110598097-110598119
Sequence CCATCTTTCCCCTCAAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936220392_936220397 -8 Left 936220392 2:110598082-110598104 CCTCCATCAGTTTGCCCATCTTT No data
Right 936220397 2:110598097-110598119 CCATCTTTCCCCTCAAGAGTGGG No data
936220388_936220397 14 Left 936220388 2:110598060-110598082 CCCACATCTCCTCTGAGGCCTTC No data
Right 936220397 2:110598097-110598119 CCATCTTTCCCCTCAAGAGTGGG No data
936220390_936220397 5 Left 936220390 2:110598069-110598091 CCTCTGAGGCCTTCCTCCATCAG No data
Right 936220397 2:110598097-110598119 CCATCTTTCCCCTCAAGAGTGGG No data
936220391_936220397 -4 Left 936220391 2:110598078-110598100 CCTTCCTCCATCAGTTTGCCCAT No data
Right 936220397 2:110598097-110598119 CCATCTTTCCCCTCAAGAGTGGG No data
936220385_936220397 23 Left 936220385 2:110598051-110598073 CCTGGCCTGCCCACATCTCCTCT No data
Right 936220397 2:110598097-110598119 CCATCTTTCCCCTCAAGAGTGGG No data
936220387_936220397 18 Left 936220387 2:110598056-110598078 CCTGCCCACATCTCCTCTGAGGC No data
Right 936220397 2:110598097-110598119 CCATCTTTCCCCTCAAGAGTGGG No data
936220389_936220397 13 Left 936220389 2:110598061-110598083 CCACATCTCCTCTGAGGCCTTCC No data
Right 936220397 2:110598097-110598119 CCATCTTTCCCCTCAAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936220397 Original CRISPR CCATCTTTCCCCTCAAGAGT GGG Intergenic
No off target data available for this crispr