ID: 936233357

View in Genome Browser
Species Human (GRCh38)
Location 2:110723771-110723793
Sequence TGTTACCAATAGAACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936233357_936233359 -5 Left 936233357 2:110723771-110723793 CCTCCAAAGTTCTATTGGTAACA No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data
936233357_936233360 24 Left 936233357 2:110723771-110723793 CCTCCAAAGTTCTATTGGTAACA No data
Right 936233360 2:110723818-110723840 TGCTCTATTTGTGAAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936233357 Original CRISPR TGTTACCAATAGAACTTTGG AGG (reversed) Intergenic
No off target data available for this crispr