ID: 936233359

View in Genome Browser
Species Human (GRCh38)
Location 2:110723789-110723811
Sequence TAACAATTTTAATTAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936233355_936233359 -3 Left 936233355 2:110723769-110723791 CCCCTCCAAAGTTCTATTGGTAA No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data
936233358_936233359 -8 Left 936233358 2:110723774-110723796 CCAAAGTTCTATTGGTAACAATT No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data
936233353_936233359 2 Left 936233353 2:110723764-110723786 CCTATCCCCTCCAAAGTTCTATT No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data
936233351_936233359 7 Left 936233351 2:110723759-110723781 CCATCCCTATCCCCTCCAAAGTT No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data
936233350_936233359 11 Left 936233350 2:110723755-110723777 CCTTCCATCCCTATCCCCTCCAA No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data
936233356_936233359 -4 Left 936233356 2:110723770-110723792 CCCTCCAAAGTTCTATTGGTAAC No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data
936233352_936233359 3 Left 936233352 2:110723763-110723785 CCCTATCCCCTCCAAAGTTCTAT No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data
936233357_936233359 -5 Left 936233357 2:110723771-110723793 CCTCCAAAGTTCTATTGGTAACA No data
Right 936233359 2:110723789-110723811 TAACAATTTTAATTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936233359 Original CRISPR TAACAATTTTAATTAGCTTC TGG Intergenic
No off target data available for this crispr