ID: 936233360

View in Genome Browser
Species Human (GRCh38)
Location 2:110723818-110723840
Sequence TGCTCTATTTGTGAAAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936233358_936233360 21 Left 936233358 2:110723774-110723796 CCAAAGTTCTATTGGTAACAATT No data
Right 936233360 2:110723818-110723840 TGCTCTATTTGTGAAAATATAGG No data
936233357_936233360 24 Left 936233357 2:110723771-110723793 CCTCCAAAGTTCTATTGGTAACA No data
Right 936233360 2:110723818-110723840 TGCTCTATTTGTGAAAATATAGG No data
936233356_936233360 25 Left 936233356 2:110723770-110723792 CCCTCCAAAGTTCTATTGGTAAC No data
Right 936233360 2:110723818-110723840 TGCTCTATTTGTGAAAATATAGG No data
936233355_936233360 26 Left 936233355 2:110723769-110723791 CCCCTCCAAAGTTCTATTGGTAA No data
Right 936233360 2:110723818-110723840 TGCTCTATTTGTGAAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936233360 Original CRISPR TGCTCTATTTGTGAAAATAT AGG Intergenic
No off target data available for this crispr