ID: 936233800

View in Genome Browser
Species Human (GRCh38)
Location 2:110726129-110726151
Sequence CTCTCTAAGGAGCTGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936233800_936233804 -7 Left 936233800 2:110726129-110726151 CCTTCCAGCAGCTCCTTAGAGAG No data
Right 936233804 2:110726145-110726167 TAGAGAGGATTTTCTTAGCCTGG No data
936233800_936233806 1 Left 936233800 2:110726129-110726151 CCTTCCAGCAGCTCCTTAGAGAG No data
Right 936233806 2:110726153-110726175 ATTTTCTTAGCCTGGCCCCAGGG No data
936233800_936233805 0 Left 936233800 2:110726129-110726151 CCTTCCAGCAGCTCCTTAGAGAG No data
Right 936233805 2:110726152-110726174 GATTTTCTTAGCCTGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936233800 Original CRISPR CTCTCTAAGGAGCTGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr