ID: 936233849

View in Genome Browser
Species Human (GRCh38)
Location 2:110726365-110726387
Sequence CTGGGGAAGGATTCAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936233836_936233849 8 Left 936233836 2:110726334-110726356 CCTGCAAGGGTGAAGCCATTAGG No data
Right 936233849 2:110726365-110726387 CTGGGGAAGGATTCAGGAGGTGG No data
936233845_936233849 -7 Left 936233845 2:110726349-110726371 CCATTAGGGGAGAGGGCTGGGGA No data
Right 936233849 2:110726365-110726387 CTGGGGAAGGATTCAGGAGGTGG No data
936233832_936233849 25 Left 936233832 2:110726317-110726339 CCTGTCCTGTTATGCTGCCTGCA No data
Right 936233849 2:110726365-110726387 CTGGGGAAGGATTCAGGAGGTGG No data
936233835_936233849 20 Left 936233835 2:110726322-110726344 CCTGTTATGCTGCCTGCAAGGGT No data
Right 936233849 2:110726365-110726387 CTGGGGAAGGATTCAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936233849 Original CRISPR CTGGGGAAGGATTCAGGAGG TGG Intergenic
No off target data available for this crispr