ID: 936234134

View in Genome Browser
Species Human (GRCh38)
Location 2:110729167-110729189
Sequence GGAAAATAATATAGTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936234131_936234134 4 Left 936234131 2:110729140-110729162 CCAAGTTTCTGGTAATTTGTTAC 0: 6
1: 135
2: 697
3: 2341
4: 5193
Right 936234134 2:110729167-110729189 GGAAAATAATATAGTGGTCAAGG No data
936234130_936234134 9 Left 936234130 2:110729135-110729157 CCTAACCAAGTTTCTGGTAATTT No data
Right 936234134 2:110729167-110729189 GGAAAATAATATAGTGGTCAAGG No data
936234128_936234134 16 Left 936234128 2:110729128-110729150 CCGTTTACCTAACCAAGTTTCTG No data
Right 936234134 2:110729167-110729189 GGAAAATAATATAGTGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936234134 Original CRISPR GGAAAATAATATAGTGGTCA AGG Intergenic
No off target data available for this crispr