ID: 936234910

View in Genome Browser
Species Human (GRCh38)
Location 2:110733859-110733881
Sequence GGGGGACCCAAGAGCATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936234910 Original CRISPR GGGGGACCCAAGAGCATTTC AGG Intronic
902099650 1:13975559-13975581 TGGGGACTCAAGAGCATGTTTGG - Intergenic
902937120 1:19772496-19772518 TGGGGAGCCCAGAGCATTTGGGG + Intronic
903445275 1:23418896-23418918 GGGGGACACAGGGGCATCTCGGG - Intronic
906748660 1:48239566-48239588 GGGGGAAGGGAGAGCATTTCTGG - Intronic
907274596 1:53310234-53310256 GAGGGGCCCAAGGGCTTTTCTGG - Intronic
907653679 1:56321036-56321058 GGGGGCCCCAGGAGCCTGTCAGG + Intergenic
910080377 1:83334568-83334590 GGGAGAGCCAAGGGAATTTCAGG + Intergenic
910762341 1:90746295-90746317 GGGGTCCCCAAGAGTCTTTCAGG - Intergenic
912601136 1:110934378-110934400 GGGGAACCCAAGAGCATGCTTGG - Intergenic
916266146 1:162891643-162891665 AGGGGACCCAAGTGGGTTTCAGG + Intergenic
920827322 1:209434135-209434157 GGGGAACCCAACAGCACATCAGG - Intergenic
924506758 1:244693341-244693363 TGGGGCCCAAAGAGCAATTCTGG + Intronic
1070830001 10:79412296-79412318 AGGGGACCCAAGAGCTTAGCAGG - Intronic
1072267990 10:93748836-93748858 GGGGGTGCTAAGAGCATTTGGGG + Intergenic
1077082657 11:731594-731616 GGGAGACCTAAGACCCTTTCAGG + Intergenic
1078855092 11:15200717-15200739 GGAGGACCCGAAAGCATATCTGG + Intronic
1082212794 11:49525900-49525922 GTGGGACCCAAGACCACCTCTGG - Intergenic
1083615924 11:64026474-64026496 TGTGGACCCAAGAGAAATTCTGG - Intronic
1086361240 11:86062123-86062145 GGGGGAGCACAGAGTATTTCAGG + Intronic
1086636802 11:89098609-89098631 GTGGGACCCAAGACCACCTCTGG + Intergenic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1093384928 12:18541365-18541387 AGGAGACCCAAGAGTATTGCCGG + Intronic
1093959751 12:25259301-25259323 GGGGGTTCCAAGACCTTTTCAGG - Intergenic
1095050980 12:37554194-37554216 GTGGGAACCAAGGGCCTTTCGGG + Intergenic
1097289702 12:57904424-57904446 GGAGGGCCCAAAAGCATTTAAGG + Intergenic
1100357535 12:93845315-93845337 GGGAGAGCAAAGAGCAGTTCTGG + Intronic
1105954254 13:25265160-25265182 GAGAGAACCAAGGGCATTTCAGG - Intronic
1112431387 13:99353796-99353818 GGAGTACCCATGAGCATCTCAGG + Intronic
1114815380 14:25951633-25951655 GGGTCACCCAAGAGCATTGATGG - Intergenic
1116560972 14:46377702-46377724 GAGGATCCCAAGAACATTTCAGG + Intergenic
1117634728 14:57729823-57729845 CTGGGACCCCAGAGCACTTCAGG + Intronic
1117777054 14:59193500-59193522 GGGGGAGAACAGAGCATTTCAGG + Intronic
1120427514 14:84367284-84367306 TGTAGACCCAAGAGCATTACGGG - Intergenic
1122244402 14:100391793-100391815 GGGGGCCTCAAGACCCTTTCAGG + Intronic
1124219287 15:27835406-27835428 GGGGGCCCAAAGAGCACTGCTGG - Intronic
1125508488 15:40280923-40280945 AGGGGGCCCTAGAGCCTTTCAGG - Intronic
1126492042 15:49247701-49247723 GAGGGGCCCAAGGGCATTTCAGG + Intronic
1129162419 15:73753867-73753889 CGGGGCCACCAGAGCATTTCAGG + Intergenic
1129491072 15:75926250-75926272 GGGGGAACCCAGAACCTTTCAGG + Intronic
1130891922 15:88140776-88140798 GGGGGCCCTAAGACCTTTTCAGG - Intronic
1130907033 15:88247982-88248004 TGGGGTGCCAGGAGCATTTCTGG - Intronic
1130966841 15:88704139-88704161 AGGGGACACAAGAGCCTTTGAGG - Intergenic
1132987244 16:2773899-2773921 GGGAGTGCCAAGAGCATATCTGG - Intronic
1134018148 16:10903662-10903684 GGGTGACCCAAGTGCATTTCTGG + Intronic
1138467536 16:57202695-57202717 GGGGGAACCAAGAACATCTGTGG + Intronic
1138916568 16:61471736-61471758 GGGGACCCCAAGAGCCTTTTTGG - Intergenic
1138966167 16:62086561-62086583 GGTGGATCAAAGAGCATTTCTGG - Intergenic
1139507082 16:67404185-67404207 GGAGGAGCCAAGAGCATGTGGGG + Intronic
1141575494 16:84960758-84960780 GGGGGAAGCAAAAGCAGTTCAGG + Intergenic
1141630496 16:85285206-85285228 GGGGAACCCAATGTCATTTCTGG + Intergenic
1142105461 16:88300021-88300043 GGGGGACGCAATGGCATTTGCGG + Intergenic
1143249860 17:5515176-5515198 GGAGGACACAGGTGCATTTCTGG - Intronic
1145371598 17:22311021-22311043 GTGGGAACCAAGGGCCTTTCGGG + Intergenic
1150843172 17:68628306-68628328 GGGGGACACAAGAGCAACCCTGG - Intergenic
1151712822 17:75816697-75816719 AAGGGACCCAGGAGCATTTTTGG + Intronic
1155294722 18:24374602-24374624 GGGGGAACCTAGAGCAGCTCTGG - Intronic
1155846609 18:30716049-30716071 GGGGTACCCATGGCCATTTCAGG + Intergenic
1156505289 18:37586792-37586814 GGGAGCCCCAAGAGCATCTAAGG + Intergenic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1157774813 18:50384488-50384510 GGGTGACCCATGATCATTGCTGG + Intronic
1161869193 19:6857288-6857310 AGGGGACCCAAGAGGAAATCGGG - Intronic
1162910267 19:13844237-13844259 GGGGGACCCTGGAGGAATTCTGG - Intergenic
1165573068 19:36791749-36791771 GTGGGAACCAAGGGCCTTTCGGG - Intergenic
1165632391 19:37312757-37312779 GTGGGAACCAAGGGCCTTTCGGG - Intergenic
1167453041 19:49583538-49583560 GGGGGACCCAGGAAGACTTCTGG - Exonic
1168476839 19:56682168-56682190 GGGGGAATCAAGACCCTTTCTGG + Intergenic
925432541 2:3807696-3807718 GAGGGGCCCAAGAGAATTTGGGG - Intronic
933654822 2:84878953-84878975 GGTGTCCCCAAGAGCCTTTCAGG + Intronic
934679461 2:96272383-96272405 GGGAGTCCCAAGACCCTTTCAGG + Intronic
934706483 2:96485127-96485149 GCGGAATCCAAGAGCATTTGAGG + Intergenic
934937619 2:98476759-98476781 GAGGGCCCCATGAGAATTTCTGG - Intronic
935246192 2:101220479-101220501 GGGGTACCCAAGACCCTTTCAGG + Intronic
935278862 2:101500462-101500484 GGGGGAACCCAGATAATTTCTGG - Intergenic
936234910 2:110733859-110733881 GGGGGACCCAAGAGCATTTCAGG + Intronic
936351558 2:111716608-111716630 GGGGGAGTCAAGAGCATAGCTGG - Intergenic
939542961 2:143515974-143515996 GAGGGAACAAAGAGCATTTTCGG - Intronic
942734703 2:179096762-179096784 GGGGGCCCCAAGAGCCTGTTTGG + Intergenic
946491640 2:220154410-220154432 GGGGCGCCCAAGAGAATTTCTGG - Intergenic
947041467 2:225926029-225926051 GGGGAAATCAAGAGCTTTTCAGG - Intergenic
948867538 2:240783351-240783373 AGGGGACCCGGAAGCATTTCAGG - Intronic
1169214205 20:3784270-3784292 GGGGGACCCCAAAGCCATTCTGG - Exonic
1170788965 20:19491961-19491983 GGGGGGCCCTTGAGCACTTCTGG - Intronic
1171223420 20:23421140-23421162 GGGGGACCCTACAGGATTTCTGG + Intronic
1171545510 20:25997648-25997670 GTGGGAACCAAGGGCCTTTCGGG + Intergenic
1173191183 20:40876698-40876720 GAGGGACCCAAGAGCCCTTTTGG - Intergenic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1176046453 20:63095288-63095310 GGGGGACCCAGTAGAATCTCGGG + Intergenic
1179279968 21:39925727-39925749 CGGGGACCCACGAGCAGTACAGG - Intronic
1182893454 22:33838786-33838808 GGGAGACCCAGGAGCCTTTGGGG - Intronic
1183399891 22:37596579-37596601 GGGGGTTCCAGGAGTATTTCTGG - Intergenic
1185321543 22:50202303-50202325 GAGGGACCGAGGGGCATTTCAGG - Intronic
1185336538 22:50273094-50273116 GGGGAACCCAATGTCATTTCAGG + Intergenic
949903597 3:8839780-8839802 GAGGGACGCCAGAGCATCTCTGG + Intronic
952084080 3:29796650-29796672 GGGTCACCCAAGAGCATTGATGG - Intronic
956726349 3:72159635-72159657 GGGAGAGCCAAGGGCATTCCAGG + Intergenic
958131869 3:89437112-89437134 TGGGTCCCCAAGAGCATTTTAGG - Intronic
962292177 3:134146158-134146180 GGGGGATCCAAGGGCCTGTCTGG - Intronic
964044817 3:152310832-152310854 GGGGAACCCATGAGAATTTCAGG + Intronic
964484964 3:157177865-157177887 GGGGGAACCAGGAGCATTGTTGG + Intergenic
966497942 3:180602099-180602121 GGGCGACCCCAGAACACTTCCGG + Intergenic
966540466 3:181084584-181084606 GAGGGCACCTAGAGCATTTCTGG - Intergenic
966864579 3:184250126-184250148 GGGGTACCCAAGACCCTGTCCGG + Intronic
969876509 4:10139539-10139561 GGGGGTCCCAGGAGCATCTTGGG + Intergenic
975252718 4:72198239-72198261 GGGGGCCCCAAGAGCCTGTCTGG - Intergenic
978198855 4:106001234-106001256 GGGGAAGGGAAGAGCATTTCAGG + Intronic
979371302 4:119890424-119890446 GGGGGCCCCATGAAGATTTCTGG + Intergenic
979736710 4:124095252-124095274 GGGGGAACCACTAACATTTCAGG + Intergenic
980994705 4:139769268-139769290 CGGGGACCCCAGAGCCTCTCTGG - Intronic
984961199 4:185100230-185100252 CAGGGACCCAAGAGCAGCTCAGG - Intergenic
988157283 5:27472086-27472108 AGGGGTCCCTAGAGAATTTCTGG + Intergenic
989463546 5:41728336-41728358 AGAGAACACAAGAGCATTTCTGG - Intergenic
990227509 5:53671808-53671830 GGGGGAAAAAAGACCATTTCTGG - Intronic
992543073 5:77783561-77783583 CTGGGGCCCAGGAGCATTTCTGG - Intronic
992768078 5:80021178-80021200 GGGGTACCTGAGACCATTTCAGG + Intronic
997292869 5:132749902-132749924 AAGGGGCCCATGAGCATTTCAGG + Intronic
999144408 5:149382855-149382877 GGGGCACCCAACAGCATTCCTGG + Intronic
1000981302 5:167819849-167819871 GGGGCACCAAGGAGCATTTGTGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1008315172 6:50030638-50030660 GGGGGATCCAAAAGGATTCCAGG - Intergenic
1009266147 6:61557098-61557120 TGGGGTCCCAAGACTATTTCAGG - Intergenic
1013009801 6:106109497-106109519 GGGAAACCCAAGAGCCTTACTGG + Exonic
1013187708 6:107775239-107775261 GGGGGAAGAAAGAGCATTCCAGG - Intronic
1018639626 6:165894546-165894568 CGGGGAGCCAAGAGTAGTTCTGG + Intronic
1019604054 7:1899655-1899677 GGGGGACCCCACACCCTTTCTGG - Intronic
1025296916 7:57782702-57782724 GTGGGAACCAAGGGCCTTTCGGG + Intergenic
1025297690 7:57789321-57789343 ATGGGATCCAAGGGCATTTCGGG + Intergenic
1026600078 7:71770573-71770595 GGCGGACCCAAGAGAAATTGAGG - Intergenic
1027153392 7:75749315-75749337 GGGGCACCCAAGACCACTCCTGG - Intergenic
1027298153 7:76799834-76799856 GGGAGAGCCAAGGGAATTTCAGG + Intergenic
1030238866 7:107297091-107297113 GGGTGACCTAAGAGATTTTCAGG + Intronic
1031328195 7:120429138-120429160 GGGGGTCCCTAGGACATTTCAGG + Intronic
1032479293 7:132233690-132233712 TGGAGACCCAAGAACCTTTCTGG + Intronic
1032578596 7:133081969-133081991 CGGGGAACCACGAGCACTTCGGG + Exonic
1032832376 7:135641206-135641228 GGAGGACTCCAAAGCATTTCAGG - Intronic
1038349515 8:26763261-26763283 GAGGACCCCAAGAGAATTTCAGG - Intronic
1042345100 8:67719205-67719227 GGGGGAACAAAGAGCATGCCAGG + Intronic
1045994929 8:108351756-108351778 TGGGGTCCCGAGAGCATTTCTGG + Intronic
1049219940 8:141424565-141424587 TGGGGACCCAGTAGCTTTTCTGG + Intronic
1053032349 9:34791827-34791849 GGGCCACCCAAGAGCATTCTAGG + Intergenic
1057146172 9:92760784-92760806 GGGAGACCCAAGGGCCTTTCAGG - Intronic
1062381659 9:136289891-136289913 GGGGGGGCCAAGAACAGTTCTGG - Intronic
1062441032 9:136569283-136569305 GGGGGAGCCCAGAGCATGTGGGG + Intergenic
1187757752 X:22545801-22545823 TGGGGAGCCAAGGGCATTTTTGG + Intergenic
1193077433 X:77369899-77369921 GGGAGACCAAAGAGCAGTTAAGG - Intergenic
1195614605 X:106902656-106902678 AGTGGACCCAGGAACATTTCTGG - Intronic
1196399686 X:115300753-115300775 GGTGGTGCCAAGAGCATCTCTGG - Intronic
1196502243 X:116398595-116398617 GGGGTGCCCAAGAGTCTTTCAGG + Intergenic
1198508830 X:137328666-137328688 GTTAGTCCCAAGAGCATTTCTGG + Intergenic
1200228290 X:154431462-154431484 GGGGCAGCCAAGAGCATTTGTGG - Intronic