ID: 936236704

View in Genome Browser
Species Human (GRCh38)
Location 2:110748335-110748357
Sequence GTGGAGTGCCCAGGATGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936236697_936236704 -3 Left 936236697 2:110748315-110748337 CCTTTTCCTCACTGCACTCCGTG 0: 1
1: 0
2: 2
3: 27
4: 231
Right 936236704 2:110748335-110748357 GTGGAGTGCCCAGGATGCAGGGG 0: 1
1: 0
2: 2
3: 32
4: 278
936236699_936236704 -9 Left 936236699 2:110748321-110748343 CCTCACTGCACTCCGTGGAGTGC 0: 1
1: 0
2: 0
3: 13
4: 100
Right 936236704 2:110748335-110748357 GTGGAGTGCCCAGGATGCAGGGG 0: 1
1: 0
2: 2
3: 32
4: 278
936236696_936236704 -2 Left 936236696 2:110748314-110748336 CCCTTTTCCTCACTGCACTCCGT 0: 1
1: 0
2: 1
3: 17
4: 266
Right 936236704 2:110748335-110748357 GTGGAGTGCCCAGGATGCAGGGG 0: 1
1: 0
2: 2
3: 32
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936236704 Original CRISPR GTGGAGTGCCCAGGATGCAG GGG Intronic
900611978 1:3548117-3548139 GTGGAGCCCCCAGCATGCTGAGG + Intronic
900736978 1:4305207-4305229 GGGGAGTGGCCAGGATGCTATGG + Intergenic
901007557 1:6179414-6179436 GTTGAGCGCCCAGGATGGGGCGG - Intronic
903404571 1:23085651-23085673 GTGGAGTGTTCGGGATGCAGGGG - Exonic
904256083 1:29255759-29255781 CTGGAGAGACCAGGATTCAGGGG - Intronic
904277226 1:29392440-29392462 CTGGGCTGTCCAGGATGCAGAGG + Intergenic
904382210 1:30119219-30119241 CCTGAGAGCCCAGGATGCAGTGG - Intergenic
905909919 1:41646672-41646694 TTGGAGTGCCCTGGAGGCAGAGG - Intronic
906689188 1:47781472-47781494 GCGCAGTGCTCAGGATCCAGTGG - Intronic
907245498 1:53105910-53105932 GTGGAGTGTCCATGATGTAGTGG - Intronic
912726573 1:112063973-112063995 GTGAAGTGGCCAGACTGCAGAGG + Intergenic
913533970 1:119753922-119753944 CTGGAGTGCCCGGAATGCAGTGG + Intronic
914826035 1:151138510-151138532 TGGGAGTGCCCAGAATGCAAGGG - Intronic
915556116 1:156661683-156661705 GTGCTGTGCCCTGGAGGCAGAGG - Intergenic
915930512 1:160057906-160057928 GTGGAGGGCCCAAGAGGTAGTGG + Intronic
916322768 1:163523148-163523170 GTGGAGTGCCCTGCCTTCAGGGG + Intergenic
916675278 1:167060111-167060133 CTCTAGTGCCCAGGCTGCAGTGG + Intronic
917609001 1:176667343-176667365 GGGGAGAGCCCAGGAATCAGGGG + Intronic
919838773 1:201594378-201594400 GTGGAGCTCCCAGGCTGCATGGG + Intergenic
920256944 1:204661918-204661940 GCAGGGTGCCCAGGGTGCAGGGG - Intronic
920654227 1:207863662-207863684 GTGAAGTTCTCAGGATACAGAGG - Intergenic
920660565 1:207911036-207911058 GCGCAGGGCCCAGGATGCCGCGG - Exonic
924786767 1:247206467-247206489 GTGGAGGGGCCAGGTTGCTGGGG + Intergenic
1062923913 10:1299991-1300013 GTGGAGGACCCTGGAGGCAGAGG + Intronic
1065342928 10:24723484-24723506 GTGGAGTGCCCGGCTTGCCGCGG - Intronic
1065411719 10:25436656-25436678 GTGGAGTGAGAAGGATGCGGTGG + Intronic
1066218734 10:33314682-33314704 GGGGAGAGCCCAGGCAGCAGTGG + Intronic
1069757313 10:70781304-70781326 GTCAAGTGCCCAGGCTGCAGTGG - Intronic
1069913952 10:71775739-71775761 ATGGAGTGTGCAGGCTGCAGGGG - Intronic
1070613296 10:77949331-77949353 GAGGAGTTCTCAGGAGGCAGTGG - Intergenic
1070650651 10:78233146-78233168 GTGGAGTCACCAGGTTGGAGGGG + Intergenic
1071291576 10:84193157-84193179 GTGGATTTCCCAGGAGCCAGAGG - Intergenic
1071432436 10:85617047-85617069 GTTTAGTTCCCAGGATGAAGGGG + Intronic
1072548117 10:96456358-96456380 GTGAAGTTCCCAGGAGACAGGGG + Intronic
1072638105 10:97190270-97190292 GAGGAGTGCCCAGGATGGACTGG - Intronic
1072706748 10:97686712-97686734 GTGGAGTGCAGAGGGTACAGAGG - Intronic
1073191210 10:101651655-101651677 GGGGAGGGCCCGGGAGGCAGTGG - Intronic
1073339608 10:102735092-102735114 GAGGAGTGACCAGGATGGGGAGG - Intronic
1073474581 10:103744504-103744526 CTGCAGTCCCCAGGCTGCAGAGG - Intronic
1075626284 10:123966545-123966567 ATGGACTGCCTAGGATGGAGGGG + Intergenic
1076555475 10:131318425-131318447 GTGAAGTGAGCAGGAGGCAGAGG - Intergenic
1076881937 10:133243846-133243868 GCGGGGTGCCCTTGATGCAGAGG + Intergenic
1077009651 11:374515-374537 GTGGAGGCCCCAGGATGAGGTGG + Intronic
1077341258 11:2027389-2027411 GTGGAGGGCCCAGGCTGCTGAGG + Intergenic
1077461718 11:2714147-2714169 GCGCAGTGCCCAGGCTGGAGAGG + Intronic
1078023610 11:7674048-7674070 GGGAAGGGGCCAGGATGCAGAGG - Exonic
1078729950 11:13964627-13964649 GTGGAGTACCCAGGATCCCGCGG - Intronic
1079259654 11:18866136-18866158 CTGGAATGCCAAGGATGCACAGG + Intergenic
1081652154 11:44831656-44831678 GTTGAGTGTCCAGTATGCACTGG + Intronic
1084189084 11:67490834-67490856 GTGGAATGCCCAGGAGGCCCAGG + Exonic
1085259400 11:75195704-75195726 GTCCAGTGGCCAGGCTGCAGAGG - Intronic
1086964768 11:93016439-93016461 GCACAGTGCCCAGGACGCAGTGG - Intergenic
1088795724 11:113265396-113265418 TTGGAGTCCCCAGCAGGCAGTGG + Intronic
1089723183 11:120449162-120449184 GTGGGGGTCCCAGGATGCTGGGG - Exonic
1089783396 11:120890799-120890821 GCTGAGTGCCCAGAATGCAAAGG + Intronic
1090239478 11:125171983-125172005 GTGGAGTGACCAGGACAGAGTGG + Intronic
1091033151 11:132209664-132209686 GTGGAATCCCCAGGAAGGAGAGG + Intronic
1202824243 11_KI270721v1_random:82578-82600 GTGGAGGGCCCAGGCTGCTGAGG + Intergenic
1091701641 12:2667263-2667285 GTGGAGTGGCCATGGTGGAGGGG - Intronic
1094713213 12:32986093-32986115 GAGAAGTGCCCAGGAGGTAGCGG - Intergenic
1096360331 12:50979936-50979958 GAGGAGTGAGCTGGATGCAGTGG + Intronic
1096602120 12:52736738-52736760 GTGGGGTCCTCGGGATGCAGGGG + Intergenic
1097668852 12:62512989-62513011 CTGGAGTGGCTGGGATGCAGGGG + Intronic
1099480747 12:83162873-83162895 GTGGAGCCCCAAGGAGGCAGTGG - Intergenic
1099594899 12:84648638-84648660 GTGTATTGCCCTGCATGCAGAGG - Intergenic
1102258204 12:111428336-111428358 CCTGAGTGCCCAGGAGGCAGTGG + Intronic
1103339401 12:120213483-120213505 GTGGGGCCCCCAGAATGCAGTGG + Intronic
1103810718 12:123611362-123611384 GTAGAGAGCACAGGCTGCAGGGG + Intronic
1103860252 12:124006747-124006769 GTCGAGTGCACAGGATGCTGGGG + Intronic
1103944652 12:124519313-124519335 CTGGAGCTCCCAGGAGGCAGAGG + Intronic
1104506075 12:129333772-129333794 GTGGGGTGCTCGGGATGGAGAGG + Intronic
1106809838 13:33349470-33349492 CTGTAGGGCCAAGGATGCAGTGG - Intronic
1107588687 13:41881170-41881192 ATGGAGTTCCCAGGTTGAAGTGG - Intronic
1108544571 13:51479988-51480010 CTCGAGTGCCCAGGAGGCTGAGG - Intergenic
1112289209 13:98130264-98130286 GTGGAGGGCTCAGCAGGCAGTGG - Intergenic
1112749753 13:102570124-102570146 CTGAATTCCCCAGGATGCAGAGG - Intergenic
1113608862 13:111629182-111629204 GGAGGGTGCCCAGGAGGCAGGGG + Intronic
1114343335 14:21768649-21768671 CTGCAGTGCACAGGATGAAGGGG + Intergenic
1116960744 14:50965735-50965757 GTGGAGAGCCCAGCCTGCTGAGG - Intergenic
1120072548 14:80120377-80120399 GTCGAATGCCTAGGATGAAGGGG - Intergenic
1120928485 14:89822490-89822512 GTGGAGTGCCAAGGGTGGGGTGG - Intronic
1123056827 14:105574786-105574808 GCGGAGGGCCCAGGCTGCCGTGG - Intergenic
1123081383 14:105696999-105697021 GCGGAGGGCCCAGGCTGCCGTGG + Intergenic
1124910794 15:33918584-33918606 GTGGTGTGCGCAGGAGGCTGAGG - Intronic
1126337207 15:47599266-47599288 GGGGAGTTACCAGGATGCAGTGG - Intronic
1126627313 15:50697324-50697346 CTGGAGTGCCCAGGCTGGAGTGG - Intergenic
1128473020 15:67972424-67972446 GTTGTGTGCCCAGGAGGAAGGGG - Intergenic
1128803717 15:70514746-70514768 GTGAAGCGCCCTGGAAGCAGAGG - Intergenic
1129686454 15:77688821-77688843 GATAAGTGCCCAGGATGCTGTGG - Intronic
1130183236 15:81652182-81652204 GTGGGGTGAGCAGGATGAAGAGG - Intergenic
1130516899 15:84632744-84632766 GCTGGGTGGCCAGGATGCAGTGG + Intergenic
1131807172 15:96135091-96135113 GTAAAGTGCCCAAGAAGCAGTGG - Intergenic
1132173374 15:99687006-99687028 GAGGTGAGCCCAGGAGGCAGAGG - Intronic
1132630321 16:914197-914219 AGGGACTGCCCAGGTTGCAGTGG - Intronic
1132718049 16:1301803-1301825 ATGGAGTTTCCGGGATGCAGCGG - Intergenic
1133181303 16:4056708-4056730 GCTGAGTGCCCATGATGCAGAGG - Intronic
1133732698 16:8590208-8590230 GTGGAGGGCCGAGGGTGGAGTGG - Intergenic
1134528926 16:14967149-14967171 ATCCAGTGCCTAGGATGCAGTGG - Intergenic
1136512627 16:30748577-30748599 GAGATGTGCCCAGGAGGCAGGGG - Intronic
1136911607 16:34148605-34148627 GGTGACTGCCCAGGATACAGTGG - Intergenic
1137895253 16:52205271-52205293 GCAGAGAGCCCAGGATTCAGGGG - Intergenic
1139867440 16:70073829-70073851 ATCCAGTGCCTAGGATGCAGTGG + Intergenic
1141555320 16:84833457-84833479 GCTGAGTGGACAGGATGCAGGGG + Intronic
1141701760 16:85645572-85645594 GTGGCGTGACCAGGAGGCAGAGG - Intronic
1141866048 16:86750724-86750746 GGGGAGGGCCAAGGATGTAGGGG - Intergenic
1142029296 16:87830591-87830613 GTGGGGTCCCCAGGCTGGAGTGG + Exonic
1142106818 16:88308876-88308898 GAGGTGAGCTCAGGATGCAGAGG - Intergenic
1142210148 16:88804833-88804855 GGCCAGTGCCCAGGATGCTGGGG + Exonic
1142952986 17:3498906-3498928 ATGGGATCCCCAGGATGCAGTGG - Exonic
1143272681 17:5687476-5687498 CTGGTGTGCCCAGCAGGCAGAGG + Intergenic
1144740020 17:17576556-17576578 GTGGGTTGCCCAGGAAGTAGGGG - Intronic
1144834743 17:18150920-18150942 CTGGCCTGCCCAGGGTGCAGGGG + Intronic
1146460539 17:33042759-33042781 GTGGAGTCCACAGGAAGCAGAGG + Intronic
1147925244 17:43941792-43941814 GTGGAGTGGCCAGCTTGGAGTGG - Intronic
1147960820 17:44166688-44166710 GTGAAGGGACCAGGGTGCAGGGG - Intergenic
1148108546 17:45132145-45132167 GTGGATTCCCCAGGCTGCACGGG - Intronic
1150811004 17:68357123-68357145 CTTGAGTGCCCAGAGTGCAGTGG - Intronic
1151530074 17:74698502-74698524 GTGGTGAGCCTGGGATGCAGGGG - Intronic
1151743700 17:76000724-76000746 GTGGGGGGCCCAGGATGCAGGGG + Intronic
1151948369 17:77331712-77331734 GTGGAGTGCAGAGAATGCACCGG + Intronic
1152026295 17:77811593-77811615 CTGAAGTGCCCAGGAAGCAGGGG - Intergenic
1152187509 17:78867169-78867191 GAGAATTGCCCAGGAGGCAGAGG + Intronic
1152539547 17:80968013-80968035 GAGGAGGGCCCAGGCTGCAGTGG - Intergenic
1156372899 18:36487462-36487484 GAGAAGTGGGCAGGATGCAGTGG - Intronic
1157333772 18:46722292-46722314 GTGGAGTGGCCAGGCTGCCTGGG - Intronic
1157504788 18:48218665-48218687 GAGCAGAGTCCAGGATGCAGAGG - Intronic
1157579824 18:48767170-48767192 GTGGGGTGCCCAGGGTGCCTGGG + Intronic
1157622905 18:49026456-49026478 GCAGAGTGCCCAGGAAGCAGGGG - Intergenic
1157918769 18:51695173-51695195 GTGGAGTGTGCAGGGTGGAGGGG + Intergenic
1160014507 18:75129788-75129810 GTGGACTGCCCTGCATGCTGAGG + Intergenic
1160265370 18:77337215-77337237 GAGGATTTCCCAGGATGCATTGG - Intergenic
1160681424 19:413226-413248 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1160681449 19:413300-413322 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1160681474 19:413374-413396 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1161364946 19:3873239-3873261 ATGGAGAGCCCAGGGTGCTGAGG + Intergenic
1161845518 19:6709887-6709909 GAGGAGTGCCTGGGATGGAGTGG + Intronic
1162828320 19:13268048-13268070 GAGTCTTGCCCAGGATGCAGTGG - Intronic
1163479763 19:17548189-17548211 GGGGGGTGAACAGGATGCAGTGG + Intronic
1163643129 19:18473151-18473173 GCGGAAGGCCCAGGATGCAGGGG + Intronic
1163821632 19:19499533-19499555 GCGCACTGCCCAGGATACAGAGG + Intronic
1164401135 19:27903142-27903164 CTGGATTGCTCAGGATTCAGGGG - Intergenic
1164987660 19:32660432-32660454 TGGGACTGCCCAGGAGGCAGAGG + Intronic
1166025736 19:40082922-40082944 GTGGAGTAGGCAAGATGCAGGGG + Intronic
1166336921 19:42113902-42113924 GTGCTGGGCCCAGGCTGCAGAGG - Intronic
1168363390 19:55762722-55762744 GAGGGGTGCCCAGGACGCACAGG - Exonic
1168364345 19:55772726-55772748 GAGGGGTGCCCAGGACGCACAGG - Exonic
1168364961 19:55778472-55778494 GAGGGGTGCCCAGGACGCACAGG - Intergenic
925389785 2:3486968-3486990 AGGGAGACCCCAGGATGCAGGGG + Intergenic
926215898 2:10905182-10905204 GTGGGGTGTGCAGCATGCAGGGG + Intergenic
929856247 2:45640704-45640726 GTAGTGTGCCCAGGAAGAAGAGG - Intergenic
930685436 2:54302459-54302481 GTGAAGTGCTCAGGAAGCAGAGG - Intronic
930851570 2:55966622-55966644 ATGGAGTGCCAAGGCTGCAAAGG + Intergenic
932317750 2:70797275-70797297 GTCTAATGCCCAGGATACAGTGG - Intergenic
933628192 2:84626640-84626662 CTCTATTGCCCAGGATGCAGTGG + Intronic
935058232 2:99586251-99586273 GAGGAGTGGGCAGCATGCAGGGG + Intronic
936236704 2:110748335-110748357 GTGGAGTGCCCAGGATGCAGGGG + Intronic
938032018 2:128003043-128003065 CTTGAGAGCCCAGGAGGCAGAGG + Intronic
941024812 2:160446880-160446902 CTGGTGTGGCCAGGGTGCAGCGG - Intronic
942145837 2:173025304-173025326 CTCTAGTGCCCAGAATGCAGTGG + Intronic
945971676 2:216237246-216237268 CTTTAGTGCCCAGGGTGCAGTGG + Intergenic
946321190 2:218955481-218955503 CTGGAGGGCCCAGGGTGAAGGGG - Intergenic
948259826 2:236595412-236595434 GAGATGTGCCCAGGATGCATTGG - Intergenic
948373549 2:237505557-237505579 GGGGAGAGCCCAGGATGGCGGGG - Intronic
948762787 2:240203048-240203070 GTAAAGTTCCCAGGGTGCAGTGG + Intergenic
1171448107 20:25218752-25218774 GCTGGGTGCCCAGCATGCAGCGG - Intronic
1171503465 20:25613312-25613334 TGGGAGTGCCCAGGACCCAGTGG - Exonic
1171906930 20:30906888-30906910 GGTGACTGCCCAGGATACAGTGG - Intergenic
1172094837 20:32455576-32455598 GGGGAGGCCCCAGGAAGCAGGGG + Intronic
1172313515 20:33935628-33935650 GGGGAGAGCCTAGGATTCAGAGG + Intergenic
1172962383 20:38807666-38807688 GCTGAGTCCCCAGGATGCTGGGG + Intronic
1175225717 20:57442731-57442753 CTGGAGTGACCAGGCTGGAGTGG - Intergenic
1175318758 20:58070777-58070799 CTGCTGTGCCCAGGATGGAGTGG + Intergenic
1176369113 21:6051984-6052006 GTGGAAGCCCCAGGAGGCAGGGG + Intergenic
1176551605 21:8225116-8225138 GGTGACTGCCCAGGATACAGTGG - Intergenic
1176570514 21:8408115-8408137 GGTGACTGCCCAGGATACAGTGG - Intergenic
1176578423 21:8452290-8452312 GGTGACTGCCCAGGATACAGTGG - Intergenic
1176917096 21:14638894-14638916 ATGGAGAGCCAATGATGCAGCGG - Intronic
1178978622 21:37242467-37242489 GTGGTGTGCTCAGGAAGCTGAGG + Intronic
1179393863 21:41019688-41019710 GAGGAGTGCCCAGGAGGTAAAGG + Intergenic
1179754406 21:43486557-43486579 GTGGAAGCCCCAGGAGGCAGGGG - Intergenic
1180081730 21:45490357-45490379 TTGGTGGGCCCAGGGTGCAGGGG + Intronic
1180632902 22:17241977-17241999 GTGGAGTGGCCAGGATCCAGGGG + Intergenic
1180922249 22:19526963-19526985 GTCGAGGCCCCAGGCTGCAGTGG + Exonic
1181591612 22:23889059-23889081 GTGGAGTCTTCAGGAGGCAGGGG + Intronic
1182461132 22:30484878-30484900 GTGCAGTGGCCAGGTTGCAGAGG + Intergenic
1182761806 22:32728466-32728488 GTGAAGTAACCAAGATGCAGAGG - Intronic
1183256536 22:36765907-36765929 CTGGGGTGCCCAGGATCCAATGG - Intronic
1183590961 22:38779087-38779109 GTGGGGCTCCCAGGATGCAAGGG + Exonic
1184005991 22:41709518-41709540 GTGCTGTGCGCGGGATGCAGCGG + Intronic
1184043471 22:41958013-41958035 CGGGAGGGCCCAGGCTGCAGAGG - Intergenic
1184842287 22:47059024-47059046 GTGGAGTGCCCAGGATGACAGGG - Intronic
1185069549 22:48648496-48648518 GTGGAGTGCTCAGGATGCCTTGG - Intronic
1185103247 22:48852916-48852938 CTGGAGCCCCCAGGATACAGTGG + Intergenic
1203256627 22_KI270733v1_random:142038-142060 GGTGACTGCCCAGGATACAGTGG - Intergenic
950138411 3:10599321-10599343 GTGGAGTGCTCAGGAGGGCGAGG - Intronic
950544235 3:13629338-13629360 GTGGAGTGCACAGAGGGCAGGGG - Intronic
953024916 3:39139235-39139257 GCGGTGGGCCCAGGATGCTGTGG + Intergenic
953505871 3:43485128-43485150 GTGGAGTGATCTGGATGGAGTGG + Intronic
953691597 3:45124495-45124517 GAGGAGTGCCCAGGATGCCAAGG + Intronic
953976263 3:47383864-47383886 GAAGAGTCCCCAGGCTGCAGTGG - Intronic
954221122 3:49154561-49154583 GTGGGGTGTCCAGGAAGTAGTGG - Intergenic
954630107 3:52043512-52043534 CTGGAGTGCACAGGCTGGAGGGG - Intergenic
954747407 3:52794974-52794996 GTGGAGTGAAGAGGAGGCAGAGG + Intronic
956138462 3:66121718-66121740 GAGGAATGCCCAGGATTCAATGG - Intergenic
956603953 3:71053018-71053040 GTGGTGGGGACAGGATGCAGCGG - Intronic
958867300 3:99516194-99516216 GTGGAAGGCGCAGGATGCAGAGG - Intergenic
960796124 3:121490392-121490414 GTGTAGTGCCCGGAAGGCAGTGG - Exonic
961391205 3:126553230-126553252 TTTGAGTTCCCAGGATGCTGGGG + Intronic
961484710 3:127208701-127208723 GTGGAGAATCCAGGCTGCAGTGG + Intergenic
961743394 3:129047393-129047415 GAGGAGAGGCCAGGAGGCAGAGG - Intergenic
962103056 3:132362827-132362849 GTGGAGAGCTGAGGCTGCAGAGG + Intronic
962309042 3:134312986-134313008 GGGCAGGGCCCAGGCTGCAGCGG + Intergenic
963314538 3:143744926-143744948 GTAGACAGCCCAGAATGCAGAGG + Intronic
963771267 3:149388727-149388749 CTGGGGTGGCCAGGAGGCAGAGG + Intergenic
965806291 3:172545934-172545956 GAGAACTGCCCAGGAGGCAGAGG - Intergenic
966917426 3:184592826-184592848 CTGAAGTGCCCAGGAAGGAGTGG + Intronic
967397610 3:189024662-189024684 ACGGAGTGCCCAGGAGGGAGGGG - Intronic
968537662 4:1144755-1144777 GGGGAGAGCTCAGGATGCCGCGG + Intergenic
969348308 4:6582840-6582862 GGGCAGAGGCCAGGATGCAGGGG - Intronic
969474240 4:7412230-7412252 GCCGAGTGAGCAGGATGCAGGGG - Intronic
969567442 4:7987064-7987086 GAGGATTGCCCAGGAAGCAGAGG - Intronic
969689869 4:8698526-8698548 GTGGAAAGACCAGGAGGCAGAGG + Intergenic
971788425 4:31135436-31135458 GTGGAGTAACCAGGATCCAGTGG + Intronic
974892434 4:67897967-67897989 CTGGAGGGCCCAGAATTCAGAGG + Intergenic
976149066 4:82075026-82075048 GTCCTGTGCCCAGGAAGCAGAGG - Intergenic
979489117 4:121304961-121304983 GTGGACTTACCAGTATGCAGTGG - Intergenic
981405806 4:144367443-144367465 ATGGAGTGCCAATGATACAGGGG + Intergenic
983800829 4:171928355-171928377 ATGGAGTCCCTTGGATGCAGTGG + Intronic
1202750623 4_GL000008v2_random:2341-2363 GTGGAGTGGACTGGATGGAGTGG + Intergenic
985490580 5:176134-176156 GTGGAGTAGCCAGGAGGCTGGGG - Intronic
986070402 5:4277618-4277640 GTGGAGAGACGTGGATGCAGAGG - Intergenic
986608553 5:9545941-9545963 GTGGAGGGCCGGGGCTGCAGCGG + Exonic
987113347 5:14707629-14707651 GTGGGGGGCCCAGGATGGGGAGG - Exonic
994092424 5:95821017-95821039 GAGGAGAACCCAGGAGGCAGAGG + Intronic
994460533 5:100064547-100064569 AGGGAGTGCCCAGGCTGGAGAGG - Intergenic
994613165 5:102071697-102071719 AAAGAGTGCCCAGCATGCAGTGG + Intergenic
995468912 5:112479689-112479711 GCAGGGTGCCCAAGATGCAGAGG + Intergenic
996816084 5:127573722-127573744 ATGGAGTGCCCATGGGGCAGTGG - Intergenic
1001872339 5:175167763-175167785 GTTGACTGAGCAGGATGCAGGGG + Intergenic
1001882008 5:175252635-175252657 CTGAAGTGCCCAGGGGGCAGTGG - Intergenic
1002107384 5:176886922-176886944 ATGGAGTGGGCAGGAGGCAGGGG - Intronic
1002340911 5:178516091-178516113 GTGGAACGCCCAGGGTGCCGTGG - Intronic
1003482602 6:6546866-6546888 GTGCAGTGCCCAGATGGCAGGGG - Intergenic
1003599379 6:7503235-7503257 CTGGAGTGGCCAGGTTGCATGGG - Intergenic
1006922418 6:37635525-37635547 GTGGCCGGGCCAGGATGCAGCGG - Exonic
1007636854 6:43304899-43304921 GTTGACTTCCCAGAATGCAGTGG + Exonic
1007650499 6:43417468-43417490 GTGGAGTGCCTAGGAGGTAGTGG - Intergenic
1008216200 6:48792870-48792892 CTTGAGAGCCCAGGAGGCAGAGG - Intergenic
1010096179 6:72049001-72049023 GTGGAGTGCTGCTGATGCAGAGG + Intronic
1010214334 6:73388561-73388583 GTGCAGTTCCCAGGAGGAAGGGG - Intronic
1012103249 6:95119314-95119336 GTGGAGCTCCCAGGTTGCAATGG + Intergenic
1013515445 6:110881307-110881329 GTGGTGTTGCCAGCATGCAGTGG - Intronic
1016989654 6:149920431-149920453 GAGAAGTGCCCAGGCTGGAGGGG + Intronic
1017884721 6:158589169-158589191 GTGGAGAGAGCAGGATGGAGAGG + Intronic
1018275071 6:162121718-162121740 GTGGGGTGGCCATGATGAAGGGG + Intronic
1018990670 6:168671376-168671398 GAGGAGGGACCAGGACGCAGGGG - Intronic
1019644083 7:2119926-2119948 GTGGAGTGAGGAGGATGCTGAGG - Intronic
1020449538 7:8305608-8305630 GGTGAGGGCCCAGGATGCTGTGG + Intergenic
1021561280 7:21971211-21971233 CTGGAGTGGCCAGAGTGCAGTGG + Intergenic
1021990740 7:26139120-26139142 GAGGTGGGCCCAGGAGGCAGAGG + Intergenic
1023836966 7:44074066-44074088 GTGGAGAGAGCAGGAGGCAGTGG + Intronic
1024304310 7:47914464-47914486 TGGGAGTGCCCATGCTGCAGGGG + Intronic
1026879471 7:73899707-73899729 ATGGGGTGCCCAGGATGCTAGGG - Intergenic
1028424821 7:90674757-90674779 CTGGAGTGGCCAGTTTGCAGGGG - Intronic
1029723736 7:102388210-102388232 GTGGATTTGCCAGGTTGCAGGGG - Intronic
1031392981 7:121238516-121238538 GAGATGTGCCCAGGATGCACTGG - Intronic
1031540694 7:122991251-122991273 GTGGTGTGGCCAGGTGGCAGTGG - Intergenic
1032089834 7:128905912-128905934 GAGGAGGGCACAGGAGGCAGGGG - Intronic
1032092411 7:128917619-128917641 GAGGAGGGCACAGGAGGCAGGGG + Intergenic
1032410463 7:131690384-131690406 GTGGACTGTCCACGGTGCAGTGG + Intergenic
1032485833 7:132286837-132286859 ATGGAGGGCCCAGGAGGCTGTGG - Intronic
1033099444 7:138457995-138458017 GTGGAGAGCTTTGGATGCAGTGG + Intergenic
1034535410 7:151723000-151723022 GAGGAGTGGGCAGGCTGCAGGGG - Intronic
1035520471 8:272303-272325 GTGGAGCTCCCAGGATGCTGGGG - Intergenic
1036824206 8:11963720-11963742 GGGGAGGGCTCCGGATGCAGGGG + Intergenic
1037901186 8:22690509-22690531 GGGGGGCGCCGAGGATGCAGAGG + Exonic
1038752912 8:30313532-30313554 GCGATGTGGCCAGGATGCAGAGG + Intergenic
1040324295 8:46333893-46333915 GTGGCGTGTTCAGGAGGCAGGGG + Intergenic
1042936111 8:74060061-74060083 GAGGTGAGCCCAGGAGGCAGAGG + Intergenic
1045141973 8:99295996-99296018 CTGTATTGCCCAGGATGGAGTGG - Intronic
1045146447 8:99349872-99349894 GTGGAGTGGCAAAGATACAGTGG + Intronic
1048135025 8:131740075-131740097 GAGGAGAGCCCAGGAGGCTGAGG + Intergenic
1048879338 8:138859825-138859847 TAGCAGAGCCCAGGATGCAGCGG - Intronic
1049424343 8:142531449-142531471 GTGGGGTGCACAGGGAGCAGGGG + Intronic
1055626033 9:78178516-78178538 GAGAGGTGCCCAGGAGGCAGTGG - Intergenic
1055901867 9:81248782-81248804 GTTGAGGCCCCAGAATGCAGTGG - Intergenic
1057185569 9:93055816-93055838 GTGATGTGCTCAGGATGGAGTGG - Intergenic
1058880167 9:109278777-109278799 ATGGAGTGCCCATTATGCACTGG - Intronic
1059396620 9:114038198-114038220 GCAGAGTGCCGAGGATTCAGAGG - Intronic
1061035222 9:128109844-128109866 GTGGACTGCCCTGGAACCAGAGG - Intergenic
1061739975 9:132695421-132695443 GTGGGGTGGGCTGGATGCAGTGG + Intergenic
1062010204 9:134263086-134263108 GTGGAGTGGCCAGGCTGGGGAGG + Intergenic
1062142935 9:134969782-134969804 ATGGGGGACCCAGGATGCAGGGG - Intergenic
1062173781 9:135149523-135149545 GTGGAGGGCCCAGGATCGATGGG + Intergenic
1062400964 9:136372449-136372471 TGGGAGTGTCCAGGAGGCAGAGG - Intronic
1062732504 9:138118028-138118050 GTGGAGTGGCCACGCTCCAGGGG - Exonic
1203472784 Un_GL000220v1:123748-123770 GGTGACTGCCCAGGATACAGTGG - Intergenic
1203351289 Un_KI270442v1:83406-83428 GTGGAGTGGAGAGGATGGAGTGG + Intergenic
1186820641 X:13284658-13284680 GCTGGGTGCCCAGGAGGCAGAGG - Intergenic
1189658174 X:43268681-43268703 GGTGAGTGCCCAGGAAGAAGAGG - Intergenic
1189829136 X:44952814-44952836 CTGCATTGCCCAGGCTGCAGTGG + Intronic
1191854156 X:65609277-65609299 GTGAAGTGTCCAGAATGCAAGGG + Intronic
1192833168 X:74771970-74771992 GTGGAATCCCCAGGATCCTGTGG + Intronic
1193198205 X:78658103-78658125 CTGGAGTTCCCAGGCTGCTGGGG + Exonic
1196945920 X:120826211-120826233 GTTGCATGCCCAGGATGCTGTGG + Intergenic
1197965572 X:132057131-132057153 GTGGAGTGGCCATGACTCAGAGG + Intergenic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1200687576 Y:6270580-6270602 GTGCGGTGTCCAGGCTGCAGTGG - Intergenic
1200830455 Y:7683998-7684020 GTGGGGTGTCCAGGCTGCAGTGG + Intergenic
1201047695 Y:9904129-9904151 GTGCGGTGTCCAGGCTGCAGTGG + Intergenic
1201062839 Y:10063239-10063261 GTGGGGTGTCCAGGCTGCAGTGG + Intergenic
1201121088 Y:10874106-10874128 GTGGAGTGCCTGGAGTGCAGTGG - Intergenic
1202116543 Y:21474026-21474048 GTGGGGTGTCCAGGCTGCAGTGG - Intergenic