ID: 936242363

View in Genome Browser
Species Human (GRCh38)
Location 2:110798993-110799015
Sequence TGATCTCGATGCCTTCCTTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936242359_936242363 17 Left 936242359 2:110798953-110798975 CCAGGACATGAGTAAAGCTATAG 0: 1
1: 0
2: 0
3: 6
4: 107
Right 936242363 2:110798993-110799015 TGATCTCGATGCCTTCCTTAGGG 0: 1
1: 0
2: 0
3: 10
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936242363 Original CRISPR TGATCTCGATGCCTTCCTTA GGG Exonic