ID: 936246258

View in Genome Browser
Species Human (GRCh38)
Location 2:110830415-110830437
Sequence AAAATGCAATAGATTTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 1, 2: 6, 3: 75, 4: 491}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936246258 Original CRISPR AAAATGCAATAGATTTATTG TGG (reversed) Intronic
900510197 1:3055434-3055456 AAAATGCAGTTTATTTAATGTGG + Intergenic
902354900 1:15890712-15890734 AAAATGCACTAGTTTCATTATGG - Intronic
902711804 1:18245500-18245522 AGAATGCAATTGATTTTTTGTGG + Intronic
904904254 1:33883064-33883086 AAAATGGAATAGCTTCCTTGGGG - Intronic
905767989 1:40619019-40619041 AAAATGCAATTGATTTTTGTAGG + Intergenic
906006279 1:42474592-42474614 AAAATGCAATTCAGTTATTTCGG + Intronic
906231358 1:44167453-44167475 AAAATGAAAAAGAAATATTGAGG - Intergenic
906638929 1:47429668-47429690 ATGATGCAAAACATTTATTGAGG + Intergenic
908062036 1:60360681-60360703 ATAATACAATGGAATTATTGTGG - Intergenic
908083720 1:60608249-60608271 GATGTGCAAGAGATTTATTGCGG - Intergenic
908103178 1:60812148-60812170 GAAGTGTAAGAGATTTATTGAGG + Intergenic
908363501 1:63393252-63393274 AAAATGCAATTAATTCTTTGGGG + Intronic
908433609 1:64082895-64082917 AAAGTGCAAGAGATTTACTGGGG - Intronic
908597016 1:65698841-65698863 AATATGCAATTAATTAATTGTGG - Intergenic
909006004 1:70277295-70277317 AAAATGCAAAAGAATTATCCGGG + Intronic
909123284 1:71632701-71632723 AAATTACAAAACATTTATTGAGG + Intronic
909164540 1:72202542-72202564 AAAGTGCAATAGCTTTATTATGG + Intronic
909963597 1:81880060-81880082 AAAATACAACTTATTTATTGAGG - Intronic
910530669 1:88231888-88231910 AAAATGCAATACAATTACTTCGG - Intergenic
910873452 1:91855878-91855900 TAAATACAAGAGATTTATTGGGG - Intronic
911237863 1:95431199-95431221 CAAATGCATCAGATTTATGGAGG + Intergenic
911292093 1:96069537-96069559 AGAATGCAATAGAATAATAGGGG - Intergenic
911505874 1:98750416-98750438 AAAATGCCATAGATTTGTTTGGG + Intronic
911909289 1:103612098-103612120 AAGATGCAATGGACTTCTTGAGG + Intergenic
912186038 1:107276935-107276957 GATATGAAAGAGATTTATTGGGG + Intronic
913193952 1:116438744-116438766 AAAATGCAACAAAATTTTTGTGG - Intergenic
915405204 1:155654954-155654976 AAATTACAATACAATTATTGAGG - Intergenic
915857004 1:159398600-159398622 AAAATGCAATTGGTATACTGAGG + Intergenic
915862478 1:159460497-159460519 GAAATGCAATAGATTTTTGTAGG + Intergenic
915985117 1:160456844-160456866 CAGATGCCAAAGATTTATTGGGG - Intergenic
918543885 1:185660664-185660686 AAAATGCAATAGAAAGAATGAGG - Intergenic
918554876 1:185786752-185786774 AAAATGCAACAGTTTTAATTTGG - Intronic
919011476 1:191970880-191970902 AAAATACAATACATATTTTGTGG + Intergenic
919323025 1:196066915-196066937 AAAATTGAAGAGCTTTATTGAGG + Intergenic
919594837 1:199548301-199548323 GAAGTGCAAGAGATTTACTGGGG - Intergenic
919631801 1:199966640-199966662 AAAGTACAAAAAATTTATTGGGG + Intergenic
920320265 1:205116262-205116284 AACATGTAATGGATTTATTATGG + Intronic
920782455 1:209007555-209007577 AAAGTAGAATATATTTATTGTGG - Intergenic
920877203 1:209847913-209847935 AAAAAGCAAGAGAGTTATTCTGG - Intronic
921111394 1:212041481-212041503 AAAATGCAATAGTTATGTTGAGG - Intronic
921735570 1:218623776-218623798 AGAATGGAATATATTTATGGTGG + Intergenic
922233192 1:223703724-223703746 GACATGCAAGAGACTTATTGGGG - Intronic
922629548 1:227091551-227091573 CAAATAAAATAGATTTATTTTGG - Intronic
922817558 1:228460742-228460764 AACATACAATAGATATATTATGG - Intergenic
923069938 1:230553955-230553977 AATGAGCAATAGATGTATTGAGG + Intergenic
923094525 1:230764005-230764027 AACATAAAAAAGATTTATTGGGG + Intronic
923175532 1:231460770-231460792 AAAATGCAAGTCATTTCTTGAGG + Intergenic
923814928 1:237366946-237366968 ATAATGCATTTGATTTATTGTGG - Intronic
924115368 1:240740212-240740234 TAAATGAAATAGATTTTTTAAGG - Intergenic
924391259 1:243561696-243561718 AAACTCCAATACAGTTATTGTGG - Intronic
924397759 1:243641521-243641543 AAAATGAAATTGAATTATTGGGG + Intronic
1063045200 10:2384669-2384691 ACAATGCCATTGATTTGTTGTGG - Intergenic
1063289397 10:4728372-4728394 AAAATGCCAAAGATTAATTGAGG - Intergenic
1063394784 10:5676861-5676883 GACGTGCAATAGATTTATTAGGG + Intergenic
1064707624 10:18089581-18089603 GAAATGGAATAGATTGAGTGTGG + Intergenic
1064708189 10:18094778-18094800 AAAAAAAAATAGATTTCTTGGGG - Intergenic
1065160079 10:22910280-22910302 AAAATGAAATATCTTTATTTTGG + Intergenic
1065237245 10:23665814-23665836 AAAGTGCAAGGGATTTATGGGGG + Intergenic
1065241941 10:23714487-23714509 AAGTTGCAATTGATTGATTGAGG - Intronic
1065775047 10:29111857-29111879 AAAATGCATTTGGATTATTGGGG + Intergenic
1065927841 10:30451797-30451819 AAAATGTTCTAGAATTATTGTGG + Intronic
1066025724 10:31358109-31358131 ATAATGGATTAGATTAATTGTGG + Intronic
1066515500 10:36154980-36155002 AAAATGTAATAGTTTTCCTGTGG + Intergenic
1068509116 10:57941260-57941282 TACCTGCAATACATTTATTGTGG - Intergenic
1069132377 10:64722517-64722539 AAAATGAATTAAATTTATTTAGG - Intergenic
1069648713 10:70026026-70026048 AAATTTCAATAGGTTTTTTGGGG - Intergenic
1070067862 10:73055794-73055816 ATAATGGCCTAGATTTATTGAGG + Intronic
1071162349 10:82763433-82763455 AAATAGCAATAGAATTATAGAGG + Intronic
1071580330 10:86763241-86763263 TAAAGGCAATACATCTATTGTGG + Intronic
1071804674 10:89104826-89104848 GAAATGCAATAGATTTGTCAAGG + Intergenic
1072153411 10:92701611-92701633 AGAATGCAACAGATTCAGTGAGG - Intergenic
1072170785 10:92859555-92859577 TATATGCAAGTGATTTATTGAGG + Intronic
1072841197 10:98775850-98775872 AAAAAGAAACAGATTTATTGGGG - Intronic
1074192672 10:111151156-111151178 GATATGCAAGAGATTTATTTGGG - Intergenic
1074299784 10:112223241-112223263 GATATGTAAAAGATTTATTGGGG - Intergenic
1074441087 10:113477930-113477952 AAAATGCATTTGCTTTATTTGGG - Intergenic
1074666543 10:115732786-115732808 AAAATTCTATAGATATATTAAGG - Intronic
1075171609 10:120120910-120120932 GAAGTGCAGGAGATTTATTGAGG + Intergenic
1077270077 11:1672472-1672494 GAAATGCAATTGATTTTTAGTGG + Intergenic
1077912911 11:6588471-6588493 AAAGTGCTATAGATCAATTGGGG + Intronic
1078389366 11:10923223-10923245 GAAATGCAATAAAGTTTTTGTGG - Intergenic
1079045230 11:17095983-17096005 AAAAGGCAAAAGGTTTATGGGGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079461445 11:20682565-20682587 AAAATTAAACAGGTTTATTGAGG + Intronic
1079540832 11:21572539-21572561 ATAGTGAAATAGTTTTATTGTGG + Intronic
1079699384 11:23524311-23524333 AAATTGCAATAAAATTATGGTGG - Intergenic
1079754359 11:24238072-24238094 TATATGCAAAAGATATATTGGGG + Intergenic
1079975384 11:27084331-27084353 TGAATGCAAGAAATTTATTGAGG - Intronic
1079982899 11:27170295-27170317 AAAGTGCAAGAGAGTTATTGTGG - Intergenic
1080223129 11:29929965-29929987 TATATGCAATAGAGTTACTGTGG + Intergenic
1081077222 11:38692726-38692748 AATATGAAATAGATTTTTTCAGG + Intergenic
1081409543 11:42740199-42740221 GATGTGCAAGAGATTTATTGGGG - Intergenic
1081419565 11:42857821-42857843 AAAATGCAAATGAATTATTAGGG - Intergenic
1082050669 11:47767872-47767894 AAAATACAAAAGATTTAGTCGGG + Intergenic
1082115044 11:48319136-48319158 AATATGCAAGAGATTTATTGGGG + Intergenic
1082258619 11:50060164-50060186 AATATGCAAGAGATTTATTGGGG - Intergenic
1083743171 11:64721861-64721883 ATAATGAAATAGATTTTTAGGGG - Intronic
1084278621 11:68071062-68071084 AAAATGAAATAGATCTTTGGAGG - Intronic
1085628482 11:78092329-78092351 AAAATGCTAATGGTTTATTGAGG - Intergenic
1086642188 11:89173489-89173511 AAAATGCAATTTATTTTTAGAGG - Intergenic
1086825974 11:91497166-91497188 AAAAAGAAATAGATTTATATGGG + Intergenic
1087385671 11:97465117-97465139 AACATGCAAGAGATTTAAAGGGG + Intergenic
1087445890 11:98253026-98253048 AATATGAAAGAGATTTATTGGGG + Intergenic
1087459553 11:98428061-98428083 AAAATTCTATACATTTATTGTGG - Intergenic
1087511137 11:99095304-99095326 AAATTGAAATACATTTCTTGGGG - Intronic
1087687858 11:101285745-101285767 AAATTGGAGTAGATTGATTGAGG - Intergenic
1087700539 11:101431760-101431782 TACATACAAGAGATTTATTGGGG - Intergenic
1087946759 11:104170895-104170917 AAAATGAAGTACGTTTATTGAGG + Intergenic
1087988719 11:104719609-104719631 CCAATGCAATTTATTTATTGGGG - Intergenic
1088007044 11:104954145-104954167 AAAATGCAACAGTTTTGTTCTGG + Intronic
1088396446 11:109375189-109375211 AAAAGCCAAAAGATTTAATGTGG + Intergenic
1088580762 11:111313822-111313844 AAAAAGAAAAAAATTTATTGAGG - Intergenic
1089762021 11:120734828-120734850 AAAATGCAATTGATATACTGAGG - Intronic
1089908470 11:122070887-122070909 AATATGCAATATATTGAATGAGG - Intergenic
1089943923 11:122447651-122447673 AAAATGCAATAGACTTGCTGTGG + Intergenic
1090985057 11:131758999-131759021 AAGATGAAATGGAGTTATTGAGG - Intronic
1092249119 12:6882437-6882459 ACAGTACAATAGATATATTGTGG - Intronic
1092621608 12:10277402-10277424 AAATAGCAATTGATTTATTTAGG - Intergenic
1092811894 12:12278825-12278847 AATGTGCAAGAGATTTATTGGGG + Intergenic
1093262492 12:16956429-16956451 AAAATGCAATAAATGCATTTGGG - Intergenic
1094177476 12:27556041-27556063 CAAAAGCAATAGATGTATTCAGG - Intronic
1094778389 12:33759331-33759353 AAAGTGCATAAGATTTATTGGGG - Intergenic
1095287298 12:40429514-40429536 AAAATGTAATGGTTATATTGAGG - Intronic
1096933102 12:55238029-55238051 AAAATGAAATAGACTTTTTCTGG + Intergenic
1097710283 12:62910162-62910184 AAAATGCAAAAGAATGAGTGTGG + Intronic
1098579428 12:72081434-72081456 AAAATGCAACAGATTCTTGGGGG - Intronic
1098986685 12:77019987-77020009 AAAAAGAAATGGATTTAGTGAGG + Intergenic
1099067260 12:77997724-77997746 AAAATGAAAAAGGTTTTTTGTGG + Intronic
1099070574 12:78041558-78041580 AAAATGTAAAATATTTATGGGGG - Intronic
1099101425 12:78446163-78446185 CAAATGCTATATATGTATTGTGG - Intergenic
1099224931 12:79958316-79958338 AAAATTCAATAAATTCTTTGGGG + Intergenic
1099310373 12:81013034-81013056 AAAAGAAAATATATTTATTGGGG - Intronic
1101260661 12:103026475-103026497 AAAGTGCAAGAGATTTACTTGGG + Intergenic
1101260888 12:103028425-103028447 AAAGTGCAAGAGATTTACTGGGG - Intergenic
1101503386 12:105325212-105325234 GGAATGCAAGAGGTTTATTGGGG - Intronic
1102120268 12:110434745-110434767 AAAATGCTCTGGATTTACTGGGG + Intergenic
1102185227 12:110942365-110942387 AACTTGCAAGAGATTTATTGAGG - Intergenic
1102636518 12:114329292-114329314 AGAGTGCAAGAGATTTATTAGGG - Intergenic
1103220771 12:119242633-119242655 AAAATTTAAGAGCTTTATTGAGG + Intergenic
1103401139 12:120643572-120643594 AAAAAGAAATAGACTTAATGAGG - Intronic
1104084955 12:125466000-125466022 TAAAGAAAATAGATTTATTGTGG - Intronic
1104557356 12:129812978-129813000 TAAATGCATAAGATTTGTTGTGG - Intronic
1105959692 13:25320501-25320523 AAAATGCAAAACATGTATTAAGG - Intronic
1106930840 13:34662719-34662741 CTAATGTAATTGATTTATTGAGG - Intergenic
1107825275 13:44323756-44323778 AAAATTCAAAAGAATTCTTGGGG - Intergenic
1107985691 13:45774352-45774374 AAAATGCATTGGTTTCATTGTGG - Intergenic
1108955012 13:56142423-56142445 AAAATGTAATAGAGTAAGTGGGG - Intergenic
1109103142 13:58212215-58212237 TAAATGCTATACATTAATTGTGG + Intergenic
1109490662 13:63095348-63095370 ATAATAGAATACATTTATTGTGG + Intergenic
1109506883 13:63313108-63313130 AAAATGCAATTGACATACTGAGG + Intergenic
1109761909 13:66841818-66841840 ATAAAGCAATAGAATCATTGTGG - Intronic
1109776275 13:67044888-67044910 AAAATACAAAAGATATGTTGTGG + Intronic
1109819273 13:67631677-67631699 AAAATACCATAGTTTTATAGGGG + Intergenic
1110301883 13:73938260-73938282 AAAATTAAATAGGTTTACTGAGG + Intronic
1110488631 13:76075869-76075891 CAAATGTAAGAGATTTATAGAGG - Intergenic
1110833779 13:80061584-80061606 AAAATGCAAAATATTTGATGGGG + Intergenic
1110945399 13:81408492-81408514 AGAATGCAATATAGTTATTTAGG + Intergenic
1111269778 13:85866147-85866169 AAAATGTTTTAAATTTATTGTGG + Intergenic
1111542170 13:89683156-89683178 AGAATGCAATTAATTTCTTGTGG - Intergenic
1112540557 13:100307763-100307785 AAAATTCAATTCATTTATTCTGG - Intronic
1112928759 13:104710243-104710265 AGAATAGAATAGACTTATTGTGG - Intergenic
1112971881 13:105271685-105271707 AAAAGGCAATTGACTTATTGTGG - Intergenic
1113046553 13:106161754-106161776 AAAATAAAATACATTTCTTGTGG + Intergenic
1114168270 14:20244367-20244389 CAAATGAAATAGATTTAGTGGGG - Intergenic
1115134053 14:30087637-30087659 AAAATGCAATTGACATATTGAGG + Intronic
1115343474 14:32317536-32317558 AACTTACAATGGATTTATTGGGG + Intergenic
1115603866 14:34981314-34981336 AAAATGGGATAGATGTATTCTGG - Intergenic
1116064779 14:39969361-39969383 AAAATGAAAAAGATAAATTGAGG + Intergenic
1116691342 14:48110073-48110095 AAAATGCCAAAGAGTTAGTGTGG + Intergenic
1116859941 14:49986692-49986714 AAAATCCTGTAGATTTATTCTGG - Intronic
1117229675 14:53703158-53703180 AAAGTGTAAGAGATTTATTTAGG + Intergenic
1118034062 14:61847987-61848009 AAAATCCAATAGCTGTTTTGAGG - Intergenic
1118175047 14:63430837-63430859 AAACTACAGTAGATTTATTGTGG - Intronic
1119005317 14:70921175-70921197 AAAATGAAATTGGTTTATTTAGG - Intronic
1119803671 14:77467721-77467743 AAGATGGAATAGATCTATTTTGG + Intronic
1121433622 14:93904285-93904307 AAAATACAATATACATATTGGGG + Intergenic
1122966218 14:105127741-105127763 AAAATACAATTGATTTATCTGGG - Intergenic
1124932694 15:34137454-34137476 TAAATGCAATAGAATAATTCTGG + Intergenic
1125154242 15:36568172-36568194 GACATGCAAGAGATTTATTGGGG + Intergenic
1125542441 15:40477741-40477763 GATGTGCAAGAGATTTATTGGGG + Intergenic
1125861156 15:43001561-43001583 AAAATGCAATGGATTTGTAATGG - Intronic
1126477517 15:49080925-49080947 AAAATGCAATAAAATAAGTGGGG + Intergenic
1127173252 15:56326142-56326164 AAATTGAAATAAATTTCTTGTGG - Intronic
1127174197 15:56336623-56336645 AGAATGCAGGAGATTTAATGGGG + Intronic
1129085355 15:73084000-73084022 AAAATTGAATATATTTATTGTGG + Intronic
1132181950 15:99761948-99761970 AAAATGAAATAAATTTCTCGAGG - Intergenic
1132360626 15:101211025-101211047 AAAATGCAATAGGTTTAGGCTGG + Intronic
1133667615 16:7984685-7984707 TCAATGCAATATAATTATTGGGG + Intergenic
1133735386 16:8611094-8611116 GATATGCAAATGATTTATTGAGG - Intergenic
1133856214 16:9551495-9551517 GACATGCAAGAGATTTATTGGGG - Intergenic
1134360588 16:13527390-13527412 AAAATGCACAAGATTTAGTCAGG + Intergenic
1135358233 16:21788630-21788652 AGAATGCAAAAGATTCATTAGGG - Intergenic
1135456737 16:22604756-22604778 AGAATGCAAAAGATTCATTAGGG - Intergenic
1139029195 16:62858957-62858979 ACAATTCAACAAATTTATTGGGG - Intergenic
1139116445 16:63959910-63959932 TTAATGCAATAAGTTTATTGAGG - Intergenic
1139163453 16:64538561-64538583 AAAATTCAATATTTTTATTCAGG - Intergenic
1140347681 16:74230023-74230045 AAAAAGCAATAGTTCTATTCAGG + Intergenic
1140682019 16:77394391-77394413 AAAAGACAATAGCTTTATTTGGG + Intronic
1141536675 16:84686186-84686208 AATTTACGATAGATTTATTGGGG + Intergenic
1141560642 16:84865534-84865556 AAAAGGCAACAGATGTATTTGGG - Intronic
1141738178 16:85869538-85869560 AATCTGCAATAGATTTTTTTTGG + Intergenic
1142117172 16:88365100-88365122 AAAATGAAATAGCATTATTTTGG + Intergenic
1142980969 17:3671295-3671317 AAAATGCATTTGTTTAATTGAGG + Exonic
1144907874 17:18651415-18651437 AAAATGGAACAGATTTATCCGGG + Intronic
1147806330 17:43134453-43134475 AAAATGCAGTGGAATTACTGAGG + Intergenic
1148167372 17:45492714-45492736 AAAATGCAGTGGAATTACTGAGG - Intergenic
1148548752 17:48536891-48536913 TAAATGCAATAGTTTTTTTTTGG + Intergenic
1148614772 17:48993098-48993120 AAAATGCAATATATATTCTGGGG + Intergenic
1149249191 17:54749015-54749037 AAAATGCAATTGACATACTGTGG - Intergenic
1149791992 17:59486567-59486589 AAATTGCAATAACTTTATTTTGG - Intergenic
1150028889 17:61710446-61710468 AAAATGCTATAGGTTTACTAAGG + Intronic
1150398555 17:64839131-64839153 AAAATGCAGTGGAATTACTGAGG - Intergenic
1152669065 17:81590681-81590703 AAACTGAAATAGAGGTATTGAGG - Intronic
1155765812 18:29630750-29630772 AAACTGCAAGAGGTATATTGGGG - Intergenic
1156026661 18:32662498-32662520 GATGTGCAATAGATGTATTGGGG - Intergenic
1156572617 18:38275705-38275727 AAAATGCAATTGACATATTGAGG - Intergenic
1157037958 18:43999521-43999543 AAAATGCATTCATTTTATTGGGG - Intergenic
1158226067 18:55202879-55202901 AAAAACCAATAGAGTTTTTGGGG + Intergenic
1158722080 18:59934141-59934163 AAAATTAAATAGATTTATTCTGG + Intergenic
1159557313 18:69958846-69958868 AAATAGCAATAGCTTTATTATGG - Intronic
1159711201 18:71763169-71763191 AATATGCAATGGAATGATTGAGG + Intronic
1159854359 18:73566490-73566512 AAAATTCAATAGGATAATTGGGG - Intergenic
1161445093 19:4313865-4313887 AAAATGCAAAAAAATTAGTGGGG + Intronic
1164775294 19:30848398-30848420 AAAAAGCTGTAGATTTCTTGTGG - Intergenic
1164955476 19:32379227-32379249 AAAATATTATAGATTTATTGAGG + Intronic
1166020082 19:40019438-40019460 AAAATAAAATAGACTTATTAAGG + Intergenic
1166514308 19:43434664-43434686 AAAAAAAAATAGCTTTATTGAGG - Intergenic
1166650893 19:44574289-44574311 AAAATGCACAAGACTTGTTGTGG + Intergenic
1168060962 19:53891965-53891987 AAAAGGGAATAGAGTGATTGAGG + Intronic
1168426459 19:56243077-56243099 ATAATACGATAGATTTTTTGAGG - Intronic
1168660257 19:58160102-58160124 GAACTGCAAAAGGTTTATTGGGG + Intergenic
928151707 2:28836589-28836611 AAAATGTAATAGAGTTGATGTGG - Intronic
928717106 2:34073831-34073853 AAAATGTCATAAATTAATTGAGG - Intergenic
929263388 2:39891872-39891894 AAAATGCATTAGATTTAAAGTGG - Intergenic
930171794 2:48259109-48259131 AAGATGCAAAAGGTTCATTGTGG - Intergenic
930272656 2:49274974-49274996 TAAAAGCAATAGAGTTTTTGAGG - Intergenic
930291769 2:49502995-49503017 GAAGTACAATAGATTTACTGGGG - Intergenic
930818879 2:55625798-55625820 GACATGCAAGATATTTATTGGGG - Intergenic
930876443 2:56223496-56223518 AAAGTGAGATAGAATTATTGAGG - Intronic
931291238 2:60875806-60875828 ACAGTGCAAGAGATTTATTGGGG - Intergenic
931521963 2:63107481-63107503 AAAATGAAACCGATATATTGAGG + Intergenic
931646682 2:64428789-64428811 TAATTGCAATAGAATTATTTTGG + Intergenic
931851244 2:66252381-66252403 AAAGTGCAATAGATAAATTATGG - Intergenic
932022253 2:68099184-68099206 CAAATGCAGAAGACTTATTGAGG - Intronic
932289526 2:70564934-70564956 AAAGCGAAATAGATTTATTGTGG - Intergenic
932675714 2:73779283-73779305 AAAATGAAGAGGATTTATTGAGG + Intronic
933342688 2:81042788-81042810 AATGTGCAAGAGATTGATTGTGG + Intergenic
933889148 2:86750111-86750133 GAAATGCAAAACATTTATTAGGG + Intronic
934016410 2:87890116-87890138 AAAGGGCAGTAGATTAATTGTGG - Intergenic
936246258 2:110830415-110830437 AAAATGCAATAGATTTATTGTGG - Intronic
937832681 2:126440811-126440833 GAAATGCCATAGATTAATGGAGG - Intergenic
937965150 2:127501033-127501055 AAAATGAAATGTATTTAATGTGG - Intronic
939176615 2:138756233-138756255 AAAATGAAAAAGATTTATATTGG - Intronic
939235115 2:139481408-139481430 AACATGCACTTTATTTATTGGGG - Intergenic
939561066 2:143732421-143732443 AAAATGCAGTATATTCTTTGTGG + Intronic
939921616 2:148122254-148122276 AAAAGTCAATAAATTTAGTGAGG - Intronic
940071570 2:149694063-149694085 AAAATGCAAAAGATTTAGTTTGG - Intergenic
940257988 2:151751865-151751887 ACAATGAAACAGATTGATTGAGG - Intergenic
940461745 2:153972593-153972615 AAAATGCTACAGATGAATTGGGG + Intronic
940822611 2:158373684-158373706 AAAGGGCTATAGATTTATTCAGG + Intronic
941107814 2:161379670-161379692 GACATGCAAGAGATTTATTGGGG + Intronic
941268679 2:163397571-163397593 GATATGCAAGAGATTTATTGGGG + Intergenic
943142141 2:183996314-183996336 AAAGATGAATAGATTTATTGAGG - Intergenic
943206226 2:184900626-184900648 AATATTCAAAAGATTTATTGGGG + Intronic
943574997 2:189620979-189621001 AATATGCAATAAAATTCTTGTGG - Intergenic
944042044 2:195366633-195366655 AAAATTCATTAGATTTTTTCCGG - Intergenic
944115075 2:196177148-196177170 AAAAAGGAAGAGATTTATTAGGG - Intergenic
944206898 2:197166113-197166135 AAAGTGGAATATCTTTATTGGGG + Intronic
944841917 2:203632566-203632588 AAAATGAAATAGAAATGTTGGGG - Intergenic
945559930 2:211327322-211327344 AAAATGCAACAAATTCTTTGTGG - Intergenic
945751267 2:213786851-213786873 ATAATACAATAAATTTATTGAGG + Intronic
945857472 2:215085745-215085767 TAACTGCAGTAGAATTATTGGGG + Intronic
946461570 2:219873328-219873350 AACATGCAACAGCTTTAGTGTGG + Intergenic
946756511 2:222952938-222952960 AAAAAAAAATAGCTTTATTGAGG + Intergenic
946816560 2:223584217-223584239 ACAAGGCAATAGATATATTCAGG + Intergenic
947022084 2:225690395-225690417 CAATTTCAAAAGATTTATTGAGG + Intergenic
947746493 2:232510595-232510617 AAAATCCAATAGTTTGATTTTGG - Intergenic
948212781 2:236207499-236207521 AAAAAGGAATAGATTCATGGGGG - Intronic
1169476959 20:5940245-5940267 GAAGTGTAAGAGATTTATTGAGG - Intronic
1169584872 20:7070040-7070062 GGAGTGCAAAAGATTTATTGAGG + Intergenic
1169802822 20:9528977-9528999 AAAATGGAATGGATAAATTGTGG - Intronic
1169817636 20:9674667-9674689 TAAATGCTCGAGATTTATTGAGG + Intronic
1170923595 20:20702314-20702336 GACATGCAAGAGATTTATTGGGG + Intronic
1172928953 20:38568652-38568674 AAAATCCACTAGAACTATTGAGG + Intronic
1173039029 20:39442754-39442776 AATCTGCAATAAATTTCTTGAGG - Intergenic
1173481650 20:43405165-43405187 GAAATACAAAAAATTTATTGTGG - Intergenic
1173764171 20:45591320-45591342 AAAATGAAAAAGATTTTTTAAGG - Intergenic
1174860874 20:54089792-54089814 AAAATGGAACAAACTTATTGAGG - Intergenic
1175566965 20:59987909-59987931 AAAATGTAATAGATTTACATAGG + Intronic
1177091377 21:16773023-16773045 AAAATGCTATATAATTATTGAGG - Intergenic
1177231325 21:18323605-18323627 ATAAGGGATTAGATTTATTGAGG - Intronic
1177454297 21:21316157-21316179 AAAAAGTAAAAGATTTATAGGGG + Intronic
1177465525 21:21474240-21474262 AAAATGTAATTGATTTATGCTGG + Intronic
1177612763 21:23474225-23474247 AAATTTCAATAGTTTTTTTGGGG + Intergenic
1177764955 21:25447471-25447493 ACAATGCAAATTATTTATTGTGG - Intergenic
1178473296 21:32914331-32914353 ATAATGGAAGACATTTATTGAGG + Intergenic
1179058520 21:37957926-37957948 AATTTGCAATATATTTATTTGGG + Intronic
1182230184 22:28831887-28831909 CCCATGCAATTGATTTATTGAGG - Intergenic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
1183560394 22:38568740-38568762 AAAATAGAATCCATTTATTGAGG - Intronic
1183656852 22:39190915-39190937 AAAAAGCTATACAATTATTGAGG + Intergenic
1183770191 22:39918008-39918030 AAAATGCTATGCATTTCTTGAGG - Intronic
949132842 3:526164-526186 AAAATGCATTTGAATCATTGAGG - Intergenic
949144263 3:677186-677208 AAAAAACAATAATTTTATTGGGG - Intergenic
949253580 3:2018370-2018392 CAGATGCAATGGATTTTTTGGGG + Intergenic
950314696 3:11990805-11990827 AAAAAACAACAGATTTTTTGGGG - Intergenic
950695394 3:14697472-14697494 AAAATGCAATTGATATACTGAGG - Intronic
950750076 3:15121478-15121500 GACGTGCAAGAGATTTATTGGGG + Intergenic
950993446 3:17466950-17466972 AAAATACTAAATATTTATTGGGG - Intronic
951495823 3:23325200-23325222 AACACACAATAGCTTTATTGTGG - Intronic
951589414 3:24246995-24247017 AAAATGCCAAAGAAATATTGCGG + Intronic
952046384 3:29326472-29326494 AATAAGCAAGAGATTAATTGTGG - Intronic
952059358 3:29489084-29489106 AATTTGCATTAGATTAATTGTGG + Intronic
952108264 3:30093396-30093418 AAAGTGAAAGAGATTTTTTGGGG + Intergenic
953583050 3:44174135-44174157 AACCTGCAACAGTTTTATTGGGG + Intergenic
953736243 3:45496450-45496472 GACATGCAAGAGATTTCTTGGGG + Intronic
953765062 3:45733620-45733642 AAAATGCAACAGATTCATCAAGG - Intronic
955110210 3:55941555-55941577 AACATGCAAGAAGTTTATTGAGG - Intronic
955185261 3:56709166-56709188 ATATTTAAATAGATTTATTGTGG - Intergenic
955311681 3:57894390-57894412 AAAATGAAATACATATATTATGG - Intronic
955424248 3:58770876-58770898 AAAATAGAATAGTGTTATTGTGG + Intronic
956226347 3:66963349-66963371 AAGATACAATAGATAAATTGGGG + Intergenic
957630342 3:82709961-82709983 GAAGTGCAAGAAATTTATTGGGG - Intergenic
958856818 3:99395268-99395290 AAATTGGAAGAGATTTTTTGGGG - Intergenic
958860089 3:99435929-99435951 AAAATGCAACATATTTTTGGGGG - Intergenic
959444443 3:106421281-106421303 GAAGTGCAAGAGATTGATTGGGG + Intergenic
959489055 3:106965400-106965422 AATATGCAATACATTTTTTAAGG + Intergenic
960044679 3:113185431-113185453 TAAGTGCAAGAGATTTATTGGGG - Intergenic
960286229 3:115832011-115832033 GAAATGCATTTGATTTATTGAGG + Intronic
960933053 3:122874084-122874106 CATAAGCAAAAGATTTATTGGGG - Intronic
962169082 3:133081722-133081744 GAAATGCAAAAGATCTATTGGGG + Intronic
963466747 3:145691383-145691405 AATGAGCAAGAGATTTATTGAGG - Intergenic
963643322 3:147883543-147883565 AAAAGCCAAAACATTTATTGGGG - Intergenic
963670074 3:148240312-148240334 AAAATGAAATATATCTATTATGG + Intergenic
964056995 3:152472991-152473013 AAAATGCAAGAGACTTAGTGGGG + Intergenic
965250961 3:166343440-166343462 AAAATGCAATTGACATCTTGAGG + Intergenic
966110940 3:176400708-176400730 AATACTCAATAGATTCATTGAGG + Intergenic
966120334 3:176513076-176513098 AAATTTCTATATATTTATTGGGG + Intergenic
966922098 3:184619137-184619159 GATATGCAAGAGATTTACTGGGG - Intronic
967495349 3:190137825-190137847 AATGTTTAATAGATTTATTGAGG - Intergenic
970296082 4:14632015-14632037 AAAATGTAATTGATTTATCTGGG - Intergenic
970847104 4:20553655-20553677 AAATCCCCATAGATTTATTGAGG - Intronic
971418473 4:26454805-26454827 TAAAAAAAATAGATTTATTGAGG - Intergenic
971639444 4:29111918-29111940 AAAAATCTATAGATTTCTTGAGG + Intergenic
971834029 4:31738078-31738100 GAATTGCAATAGACTTATTGAGG - Intergenic
971871039 4:32238733-32238755 TAAAGGCAATTGATTTATTTGGG - Intergenic
972187219 4:36544803-36544825 CAAATGCACTGCATTTATTGTGG + Intergenic
972864737 4:43216991-43217013 AAAATAAAATATATTTATTATGG + Intergenic
973076235 4:45930233-45930255 AAAATGTAATAGAATAATAGGGG - Intergenic
973247702 4:48027149-48027171 AAAAAGCAAATGATATATTGGGG + Intronic
973901494 4:55477934-55477956 AAAAAGCTATTGCTTTATTGAGG + Intronic
974142339 4:57903079-57903101 ATAATGCATTAGAGTTATTGTGG + Intergenic
974204859 4:58688454-58688476 AAAATGCAATAAACATTTTGTGG + Intergenic
974655541 4:64815003-64815025 ATAATTCAATTGATTTTTTGTGG + Intergenic
975246694 4:72128475-72128497 AAAATGCCATGGAATTTTTGTGG - Intronic
975258625 4:72269946-72269968 AAAATGCAAAAGATTTTAAGCGG + Intergenic
975988736 4:80234323-80234345 AAAGTGTATTAGATTTATTCTGG - Intergenic
977635068 4:99287888-99287910 AAAATGGAATATATTCATTAAGG + Intronic
977637723 4:99319105-99319127 AAAATGGAATATATTTATTTAGG + Intronic
977640110 4:99348072-99348094 AAAATGGAATATATTCATTTAGG + Intronic
977722345 4:100254370-100254392 GACATGCAAGAGATTTATTGTGG + Intergenic
977820501 4:101466339-101466361 AAAATTCAAGAGATACATTGGGG - Intronic
977883298 4:102231127-102231149 AAAATGTAAGAGAATTAGTGTGG + Intergenic
978346293 4:107773648-107773670 AAAAAGCAATGGATTTATTAGGG + Intergenic
979129453 4:117023215-117023237 CAAATGCAAAATAATTATTGAGG + Intergenic
979144285 4:117221631-117221653 GAAAAGTAATAGATTTAATGTGG + Intergenic
979685123 4:123503603-123503625 CAAGTGCATTACATTTATTGTGG + Intergenic
980222311 4:129934940-129934962 AAATAGCAATACATTTATTCAGG - Intergenic
980547119 4:134279739-134279761 AAAGTGTAATCTATTTATTGTGG - Intergenic
981039401 4:140209598-140209620 GACATGCAAGAGATTTATTGGGG + Intergenic
981127867 4:141127581-141127603 AAAATGTAGTAGATCTACTGAGG - Intronic
981129283 4:141140480-141140502 AAAAGGAAACAGATGTATTGTGG - Intronic
981276908 4:142910819-142910841 AAAATGCAAAAGAAATATTCTGG - Intergenic
981620790 4:146696300-146696322 AAAATGCTATAAGTTTATTCTGG - Intergenic
981801129 4:148658096-148658118 AAAATAAAATATTTTTATTGTGG + Intergenic
982560578 4:156924589-156924611 AAAATGCAAAAAGTTTATTAGGG + Intronic
982589424 4:157287171-157287193 AAAATCCAATGGATTGATTTAGG - Intronic
982873685 4:160616706-160616728 AAACTATGATAGATTTATTGGGG + Intergenic
983017392 4:162629699-162629721 AAAATGCAATTGACATACTGAGG + Intergenic
983315265 4:166124070-166124092 AAAATTCCATAGCTTTACTGAGG - Intergenic
983365551 4:166783061-166783083 AAAATGAAGTAGATTTGGTGGGG + Intronic
983430660 4:167646467-167646489 GAAAGGCAATAGATTCATGGTGG - Intergenic
983450361 4:167902439-167902461 AAAATGCAATTGATTTTTATTGG - Intergenic
984112071 4:175629078-175629100 AAAATGGAGTAGGTTTATTGGGG + Intergenic
984365621 4:178795624-178795646 AAAATGCTATAAATTGATAGAGG - Intergenic
984517250 4:180756085-180756107 AAAATAAAATAAAATTATTGGGG - Intergenic
984529063 4:180893580-180893602 TTAATGATATAGATTTATTGTGG - Intergenic
984544396 4:181083391-181083413 AAAATGAAATAGATAAATTTGGG - Intergenic
984737630 4:183125531-183125553 AAAATGAAAAAGATTTAGTTTGG + Intronic
986018896 5:3782507-3782529 AAAATGCATAAAATTTATGGAGG + Intergenic
986942033 5:12965135-12965157 AACATGGAATAAATTTATTCAGG - Intergenic
987440147 5:17945654-17945676 GACATGCAAAAGATTTATTAGGG - Intergenic
987526721 5:19060357-19060379 AAAATAGAATAAATTAATTGTGG - Intergenic
987928333 5:24370500-24370522 AAAATTTAACAGCTTTATTGAGG + Intergenic
989244430 5:39238340-39238362 AAAATGCATTATATTTTTTTAGG + Intronic
989249160 5:39288243-39288265 AAAAGGCAATAGAATTTTTTTGG + Intronic
989311963 5:40029928-40029950 AAATTGCAACAGAGTTATTCTGG + Intergenic
989519537 5:42384330-42384352 GATATAAAATAGATTTATTGGGG + Intergenic
989635614 5:43529797-43529819 AAAATGGAACAGATTTATCCGGG - Exonic
990631467 5:57674789-57674811 AAAATAAAAGAGATTTATTGGGG - Intergenic
991012271 5:61896603-61896625 AATACCCAATAGGTTTATTGTGG - Intergenic
991150208 5:63359180-63359202 AACATGCAAGTGATTTATTAAGG - Intergenic
991569000 5:68034901-68034923 AAAATGGAATAGTGTTATTTTGG + Intergenic
991629229 5:68637973-68637995 AAAATACAATAGACATTTTGGGG + Intergenic
991728154 5:69558126-69558148 AATATGCTTTATATTTATTGGGG + Intergenic
991804583 5:70413273-70413295 AATATGCTTTATATTTATTGGGG + Intergenic
991866801 5:71069749-71069771 AATATGCTTTATATTTATTGGGG - Intergenic
992775821 5:80088106-80088128 AGAATGCAATAAATTCAATGTGG + Intergenic
992882662 5:81125959-81125981 AAAATGCAATAAGTCTGTTGTGG + Intronic
993271222 5:85798921-85798943 AAAATGGAGTAGGTTTAGTGGGG + Intergenic
993910327 5:93674642-93674664 AAAATGCACATGGTTTATTGGGG + Intronic
994828083 5:104742500-104742522 TCTATGCAAGAGATTTATTGAGG - Intergenic
994854835 5:105105086-105105108 AAAATGAATAAGATTTAATGAGG + Intergenic
995280011 5:110323538-110323560 AAAAAGCAATAAATTAATAGTGG + Intronic
995287101 5:110402297-110402319 AAGATGTAAAAGATTTATTCAGG - Intronic
996148669 5:120008158-120008180 AAAATAAAATAAACTTATTGAGG - Intergenic
996166273 5:120227871-120227893 AAAATGCAATTGACATACTGAGG - Intergenic
996179774 5:120405090-120405112 AAATACCAATAGTTTTATTGAGG - Intergenic
997256719 5:132434645-132434667 AAAGTGCAGAAGATTTATTGGGG + Intronic
997308697 5:132861353-132861375 TAAATGAAATATAATTATTGTGG - Exonic
997785200 5:136704361-136704383 AAACTGCAATACAATAATTGTGG + Intergenic
998635715 5:143952725-143952747 AAAAGGCAATTTATTGATTGAGG + Intergenic
999742074 5:154563602-154563624 AAAATGGAATAGTTTTTTTCTGG - Intergenic
999929408 5:156414208-156414230 AAAATGCAATAAAATGTTTGTGG - Intronic
1000174059 5:158733067-158733089 AAAATGCCATAGAATTCTTTAGG + Intronic
1000312814 5:160061804-160061826 AAAGTACAAGAGATTTACTGGGG + Intronic
1000846953 5:166293541-166293563 AAAATGCAGAAGATTTATCAAGG + Intergenic
1000918944 5:167116129-167116151 TACATGCAAGAGATTTATTGCGG + Intergenic
1000970842 5:167712830-167712852 AAAATGCAGTATATTTCTTTCGG + Intronic
1001925973 5:175637473-175637495 AAATGCAAATAGATTTATTGAGG + Intergenic
1003712994 6:8614347-8614369 CAAGTGCATTATATTTATTGTGG - Intergenic
1004089144 6:12482006-12482028 AACAAGTCATAGATTTATTGAGG + Intergenic
1004131373 6:12923092-12923114 CACAGGCAATAGATTTATGGAGG - Intronic
1004473257 6:15947762-15947784 GATGTGCAAGAGATTTATTGGGG + Intergenic
1004588803 6:17029130-17029152 GCCATGCAAGAGATTTATTGGGG + Intergenic
1004776290 6:18849247-18849269 AAAAAGCATAAAATTTATTGTGG + Intergenic
1005307868 6:24530997-24531019 AAAATGCAAGACATTTCTGGAGG - Intronic
1005675644 6:28152092-28152114 AAAATGCATGAGATTTACTGGGG - Intronic
1005695852 6:28352120-28352142 AAAATGCCATTTATTTGTTGAGG + Intronic
1006568094 6:34976941-34976963 CAAATGTAATAAATGTATTGTGG - Intronic
1006880991 6:37339620-37339642 AAAATGAAATAGTTTTAATGGGG + Intergenic
1007201947 6:40116879-40116901 AAAGTACAAGAGACTTATTGGGG - Intergenic
1008755277 6:54787763-54787785 AAAATGCAATAGTTATTTTGGGG - Intergenic
1008890937 6:56489085-56489107 AAAAAGTAATAGATATTTTGCGG - Intronic
1008955538 6:57212421-57212443 AAAGTGCAAGAGATTTATTGGGG - Intronic
1009339391 6:62534397-62534419 GACATGCAGGAGATTTATTGGGG - Intergenic
1009529253 6:64788957-64788979 AAATTGCAATCACTTTATTGAGG - Intronic
1009602364 6:65818570-65818592 AAATTATAATAGATTTAATGAGG - Intergenic
1009789321 6:68380847-68380869 CAATTGCAATAGTTTTCTTGTGG + Intergenic
1009917726 6:70016537-70016559 AAAATTTAACAGCTTTATTGAGG - Intronic
1010294990 6:74185249-74185271 GACATGCAATAGATTTATTGAGG + Intergenic
1011124934 6:83996976-83996998 AAATTGTAATAGCTTTATTGAGG - Intergenic
1011866160 6:91830870-91830892 GAAATGCAATTGATTCACTGAGG + Intergenic
1011904137 6:92340050-92340072 ACACTCCCATAGATTTATTGAGG + Intergenic
1011984777 6:93429779-93429801 AAAACACCATAGATTCATTGAGG - Intergenic
1012200374 6:96398864-96398886 AAAAAAAAATAGATTTGTTGGGG - Intergenic
1012381799 6:98629038-98629060 ATAATGCAATAGATTGATTTGGG + Intergenic
1012995322 6:105967123-105967145 TAAATGAAATAGATTTATACTGG + Intergenic
1013009742 6:106108690-106108712 AAAATACAATTGATGTGTTGGGG - Exonic
1014251480 6:119119668-119119690 AAAAAGTAATAGCTATATTGAGG + Intronic
1014499346 6:122165640-122165662 AAAATGCAACAGAATCTTTGAGG + Intergenic
1014509239 6:122300644-122300666 AAACTGCAAGAGATTTATTGAGG + Intergenic
1014669775 6:124287556-124287578 AAAATGAAATAGATGTTTTCAGG + Intronic
1015351303 6:132223502-132223524 AAAATGCAATAGATCTGTCAAGG + Intergenic
1016064401 6:139664406-139664428 AAAAAACAAGAGATTTATTTTGG + Intergenic
1016613268 6:146017495-146017517 ACAATACAATAAATTTATTAAGG + Intergenic
1016888880 6:148985887-148985909 GATGTGCAAGAGATTTATTGGGG + Intronic
1018920875 6:168172156-168172178 AAAACCAGATAGATTTATTGCGG + Intergenic
1019025587 6:168960293-168960315 AAAATGCAAGACATTTATTAGGG + Intergenic
1020282783 7:6658725-6658747 AAAATGAAATAGATTTAAAGAGG - Intergenic
1020528423 7:9295458-9295480 AAAATGCATTATAATGATTGGGG + Intergenic
1020986829 7:15146389-15146411 AAAATGTGATAGAATTATTAGGG + Intergenic
1021391859 7:20102689-20102711 ATATTGAAATAGTTTTATTGAGG + Intergenic
1021493969 7:21252076-21252098 AAAATGCAATAGAATTCCTATGG + Intergenic
1022019976 7:26389537-26389559 AAACTGAAATAGCATTATTGTGG + Intergenic
1022173094 7:27848276-27848298 AAAAAGGAATAAATTTAATGAGG - Intronic
1022215246 7:28253268-28253290 AACATGCAAGAGACTTATTAGGG - Intergenic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1024801225 7:53082267-53082289 AATATCCAGTAAATTTATTGTGG + Intergenic
1024828317 7:53418535-53418557 AAAGTGCCATAGATTTCTTGAGG - Intergenic
1025272236 7:57533884-57533906 AAAATCCAATATCTTTATTATGG + Intergenic
1027347839 7:77279999-77280021 AAAATAAAATACATTTATAGAGG + Intronic
1027941541 7:84687869-84687891 AAAATGCATCACATTTTTTGAGG + Intergenic
1028749088 7:94362203-94362225 AATGTGCAATCAATTTATTGGGG + Intergenic
1028947173 7:96593153-96593175 AAAATGCAAAAGAAACATTGAGG - Intronic
1029819217 7:103129417-103129439 AAAATACTATAGATTTATGAAGG - Intronic
1030382168 7:108824750-108824772 GATATGCAAGAGACTTATTGAGG + Intergenic
1030610721 7:111686194-111686216 AAAATGCCATCGGATTATTGAGG + Intergenic
1031301320 7:120064690-120064712 CAAATGCAAAAGAGTGATTGGGG - Intergenic
1031348155 7:120694631-120694653 AACATGAAATAGAATTATGGTGG - Intronic
1031536981 7:122946829-122946851 GACATGCAAAAGATTTATTGGGG + Intergenic
1031537125 7:122948315-122948337 AATATGGAAAATATTTATTGGGG + Intergenic
1031688635 7:124763498-124763520 AAAATGCAATAATCTTCTTGGGG + Intronic
1032627927 7:133612771-133612793 AAAATGGAAAGGATTTACTGAGG + Intronic
1033516472 7:142111690-142111712 ATAAGGCAATAAATTAATTGTGG + Intergenic
1033868408 7:145720049-145720071 AAAATGCATTAGACTTATCAGGG + Intergenic
1033978188 7:147128176-147128198 AAAATTCATTAGATTTATTTTGG - Intronic
1033984403 7:147205848-147205870 AATATGCAATAAATTAATTGTGG - Intronic
1034599945 7:152241177-152241199 AAAATGCCAGACATTTATTGAGG - Intronic
1035915498 8:3616821-3616843 AAAATGCTGTATAGTTATTGAGG + Intronic
1036028017 8:4931829-4931851 AAAATGCAGTATATTTTTAGGGG + Intronic
1037219768 8:16504511-16504533 GACATGCAAGAGATTTATTGGGG + Intronic
1037242727 8:16795776-16795798 AAAATGAAATAGATTTCTGGGGG + Intergenic
1037509267 8:19565013-19565035 GAAATGCAGTGGATTCATTGAGG - Intronic
1038390058 8:27189256-27189278 AATATACAAGGGATTTATTGAGG + Intergenic
1038516241 8:28189930-28189952 AAAACGCAAGTGATTTTTTGGGG - Exonic
1041266609 8:56071884-56071906 AAGTTTCTATAGATTTATTGTGG - Intronic
1041834586 8:62197501-62197523 GATGTGCAAGAGATTTATTGAGG + Intergenic
1041977268 8:63814314-63814336 AAAATGTAATAGCTGTTTTGGGG + Intergenic
1042160204 8:65885458-65885480 AAAATGCATTAGAGATATGGTGG - Intergenic
1042396245 8:68294830-68294852 AAAATGCCAATGATTTATTTTGG + Intergenic
1042437772 8:68787587-68787609 AAAGTGAAATAGCTTTATTGTGG - Intronic
1043328501 8:79083445-79083467 ACAGTGCAATAGATTAATAGAGG + Intergenic
1043692956 8:83180344-83180366 AAAATGAGAAAGTTTTATTGGGG + Intergenic
1043723021 8:83571568-83571590 AAAATGTAATAGTATTATTTAGG - Intergenic
1043760020 8:84056895-84056917 AAAATGTAATTGAGTTATTATGG - Intergenic
1044263988 8:90161361-90161383 AAAAAGATATAGTTTTATTGAGG + Intergenic
1045321989 8:101089181-101089203 GAAATGCAAAAGATTTATTGGGG + Intergenic
1045953559 8:107879988-107880010 AAAATGAAATAGAGTTATTTGGG - Intergenic
1046024066 8:108700949-108700971 AAAAGGAAATAGATGCATTGAGG + Intronic
1046201195 8:110929456-110929478 TAAATGCAACAGAATTATTTTGG - Intergenic
1046470614 8:114668796-114668818 AAAATACATTTAATTTATTGAGG + Intergenic
1047510923 8:125514749-125514771 AAAATTCAAGAGATTTTCTGTGG + Intergenic
1047588832 8:126304280-126304302 GGTATGCAAAAGATTTATTGGGG + Intergenic
1048224034 8:132567664-132567686 GAACTGCAAGAGATTTACTGGGG - Intergenic
1050793457 9:9505149-9505171 AACATGCAAATGATTTATTAGGG - Intronic
1051012467 9:12434635-12434657 AAACTGCAATACAATTATAGTGG - Intergenic
1051903043 9:22063473-22063495 AAAATTGAAGAGATTAATTGAGG + Intergenic
1052063705 9:23991620-23991642 AATTTGTAATAGTTTTATTGTGG - Intergenic
1052091055 9:24328276-24328298 AACATGCAATAGAAGTAATGTGG + Intergenic
1053112986 9:35478694-35478716 AAAAGAAAATAGAGTTATTGGGG + Intergenic
1055353796 9:75416971-75416993 AAAGTTCTATACATTTATTGGGG + Intergenic
1055505359 9:76942587-76942609 TACATGCAGGAGATTTATTGGGG - Intergenic
1055584099 9:77738513-77738535 AAAATACAATAGTTTTATGTGGG - Intronic
1056111513 9:83400551-83400573 AAAAGGCAAAAGATTTAGAGTGG + Intronic
1058634767 9:107025949-107025971 AGAAAGCAAGAGATTTATTATGG - Intergenic
1059024173 9:110606422-110606444 AAAATAAAATAGATTTCTTAGGG - Intergenic
1059482750 9:114604417-114604439 AAAATACAAAAAATTTACTGGGG + Intergenic
1059770681 9:117421340-117421362 AAAATGCAAAAGAATGAGTGAGG - Intergenic
1060452140 9:123753006-123753028 ATAATGCATTTGATTTATAGTGG + Intronic
1061524006 9:131142580-131142602 AAAATGCTTTTGATTTATTTAGG + Intronic
1186115307 X:6299276-6299298 AGAATGTATTAGATTTATTGAGG - Intergenic
1187151781 X:16687717-16687739 AAAATGCTTTAGATTTTCTGGGG - Intronic
1188164649 X:26846935-26846957 AAAATGTTAAAGATTGATTGTGG - Intergenic
1188234457 X:27709846-27709868 AAAAAGCAAAAGATTAAATGTGG + Intronic
1188316895 X:28686174-28686196 AATATGTTATAGACTTATTGAGG - Intronic
1188338090 X:28963391-28963413 AAATTGATATAGATATATTGGGG - Intronic
1188382512 X:29513833-29513855 AAAATGTATTACATTAATTGAGG - Intronic
1188735790 X:33713615-33713637 AAAATGTTTTAAATTTATTGAGG - Intergenic
1189121529 X:38400441-38400463 GACTTGCAAGAGATTTATTGAGG + Intronic
1189477530 X:41367478-41367500 AAAATGGATTAAATGTATTGTGG - Intergenic
1189684728 X:43552007-43552029 AAAATGCAAGCAGTTTATTGAGG - Intergenic
1189752241 X:44234101-44234123 AATATGCAAGAGATTTAATAGGG - Intronic
1190031502 X:46977682-46977704 CAAATGCACATGATTTATTGAGG + Intronic
1191983947 X:66958622-66958644 AAAATGCAATTGGTTTACTGAGG - Intergenic
1192111013 X:68364353-68364375 AGATTGCAATAGATTTCTGGGGG - Intronic
1193169865 X:78323059-78323081 AAAAGGCAATAGAGATCTTGAGG + Intronic
1193500867 X:82273539-82273561 GAAATGCAATTGATTTTTGGAGG - Intergenic
1193543263 X:82796691-82796713 AAAATGCCATAGATCCATTTGGG - Intergenic
1194270913 X:91814062-91814084 AAAATGCACTTGATTTTGTGAGG + Intronic
1194940153 X:99999402-99999424 GATTTGCAATAGATTTATTGAGG + Intergenic
1195032043 X:100935778-100935800 GATATGCAAGAGATTGATTGAGG - Intergenic
1195403525 X:104487881-104487903 AAAATACAATATTTTTATTGTGG - Intergenic
1196315585 X:114219114-114219136 AAAATGCAAGAGGTTTACTGGGG + Intergenic
1196569151 X:117245363-117245385 AAAATGCAATAATCTTTTTGAGG - Intergenic
1196915666 X:120532679-120532701 AAAATGAAATAGTTTTAATAGGG - Intronic
1197615658 X:128687745-128687767 AAATTGAAAGAGATTTATAGGGG + Intergenic
1198428432 X:136542365-136542387 AAAATGCACTAATTTTAGTGTGG - Intronic
1198832873 X:140769671-140769693 AAACTGTAAAAGATTTGTTGAGG - Intergenic
1199128075 X:144148424-144148446 AAAGGGCAGTAGATTAATTGTGG + Intergenic
1200588154 Y:5035498-5035520 AAAATGCACTTGATTTTGTGAGG + Intronic
1200937082 Y:8747775-8747797 AAATTGCAATAGATTGATGCTGG - Intergenic
1201351826 Y:13052417-13052439 AAAATGCTATAGATTCCTTTGGG - Intergenic
1201731519 Y:17209816-17209838 AAAATGCATTAGATGTTTTTAGG + Intergenic