ID: 936252215

View in Genome Browser
Species Human (GRCh38)
Location 2:110875675-110875697
Sequence GTGGAATTGCATCCTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936252205_936252215 24 Left 936252205 2:110875628-110875650 CCTCGATCCTATCATTCCAAAGG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 936252215 2:110875675-110875697 GTGGAATTGCATCCTGCAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 109
936252209_936252215 8 Left 936252209 2:110875644-110875666 CCAAAGGGAAAGCTACTTTTCTA 0: 1
1: 0
2: 1
3: 14
4: 235
Right 936252215 2:110875675-110875697 GTGGAATTGCATCCTGCAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 109
936252208_936252215 17 Left 936252208 2:110875635-110875657 CCTATCATTCCAAAGGGAAAGCT 0: 1
1: 0
2: 1
3: 20
4: 171
Right 936252215 2:110875675-110875697 GTGGAATTGCATCCTGCAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936252215 Original CRISPR GTGGAATTGCATCCTGCAGT GGG Intronic
904968308 1:34398273-34398295 GTGGAATTGCATCTTAAATTGGG - Intergenic
906315782 1:44785635-44785657 GTGGAATAGCATGCTGCACTTGG + Exonic
907996689 1:59639948-59639970 TTGGAATTTCATTCTGCATTTGG - Intronic
908088098 1:60658264-60658286 GGGGATTTGCTCCCTGCAGTTGG - Intergenic
909595195 1:77398856-77398878 ATTGAATTGCATCCTGTAGGTGG + Intronic
912360832 1:109093600-109093622 GTGGAATTCCTCCCTTCAGTGGG + Intronic
912957399 1:114165183-114165205 GTGGAATTTTCTCCAGCAGTGGG + Intergenic
918392498 1:184081386-184081408 CTGGAACTGCCTCCTGCAGCTGG - Intergenic
1062847645 10:719913-719935 GTGGAAAAGCATCCTGCAGAAGG + Intergenic
1066061383 10:31726448-31726470 GTGGAATTGCATCTTATACTGGG - Intergenic
1071182776 10:83006214-83006236 GTGGAATAGTAGCCTGCAGTGGG + Intergenic
1075445629 10:122510650-122510672 GTGGAATTGCGGCCTGTGGTTGG + Intronic
1080081490 11:28223488-28223510 ATGTAATTGCAACCTGTAGTAGG + Intronic
1081653990 11:44845171-44845193 GTGGAATTTAGTCCTGCATTTGG + Intronic
1084666731 11:70580448-70580470 GTCCAATTTCATCCTGCAGGAGG - Intronic
1089414041 11:118272144-118272166 TTGGACTAGCCTCCTGCAGTAGG + Intergenic
1089850959 11:121496065-121496087 TTGGAATTGGATGCTGCAGAGGG + Intronic
1090521226 11:127481576-127481598 TTTGAATTGCATCCTTAAGTTGG - Intergenic
1092845974 12:12585683-12585705 GTGGATTTGGCTCCTGCAATAGG - Intergenic
1099706721 12:86163269-86163291 CAGGAATTGGAGCCTGCAGTAGG - Intronic
1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG + Intronic
1105649969 13:22366293-22366315 GTGGATTTGTATCCAGTAGTGGG - Intergenic
1106150019 13:27091045-27091067 GTGGAATGGCATCTTACAGAAGG - Intronic
1107770021 13:43779506-43779528 GCAGAATTGCATCCTGAAGCAGG + Intronic
1113463915 13:110500883-110500905 GTTGAAGTGCATCCTACTGTTGG - Intronic
1114589450 14:23846970-23846992 ATGGAATTGCATTCTTCATTTGG + Intergenic
1115838777 14:37442141-37442163 ATGGAATTGCATTCTGGAATTGG + Intronic
1116027610 14:39534350-39534372 CTGGAGTTGAATTCTGCAGTGGG - Intergenic
1117632165 14:57705188-57705210 CTGGAATTCAATCCAGCAGTAGG + Intronic
1121373016 14:93377812-93377834 GTGGTCTTTCATACTGCAGTGGG - Intronic
1121927972 14:97946510-97946532 GTTGATTTGCATCATGCAGGTGG - Intronic
1122571427 14:102705201-102705223 ATAGGATTGCATCCTGCTGTGGG + Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1128499738 15:68219617-68219639 GTTGAAATGCTCCCTGCAGTGGG - Intronic
1128868795 15:71136685-71136707 GTGGAACTGGCGCCTGCAGTGGG + Intronic
1129741040 15:77989789-77989811 GTGGGATTGGCTCCTGCAGAGGG - Intronic
1131212585 15:90510585-90510607 GTGGGATTGCTTACTGCAGTGGG - Intergenic
1136563254 16:31053781-31053803 GTGGAATGGCATGGTACAGTAGG - Intergenic
1141263417 16:82474371-82474393 GCAGAATTGCATCCTGGAATTGG + Intergenic
1144063047 17:11599967-11599989 CAGGACTTGCATCCAGCAGTGGG - Intronic
1155252951 18:23968822-23968844 CTGGAATTGCATGGTGCAGGTGG + Intergenic
1157647613 18:49292570-49292592 GTGGAATTGCATTTTCCTGTTGG + Intronic
1159455105 18:68651404-68651426 CTGGAAATGTATCCTGCAGTTGG + Intergenic
1164593479 19:29518964-29518986 CTGGCATTGCTGCCTGCAGTGGG - Intergenic
1166931608 19:46304586-46304608 TTAGAATTGCATCCTGCAGCGGG + Intronic
1167188041 19:47961612-47961634 CTGGAAGAGCATCTTGCAGTGGG - Intergenic
1167290200 19:48620342-48620364 CTGGAAGGGCCTCCTGCAGTTGG + Intronic
926985150 2:18614383-18614405 GTGGAATGACAGCCTCCAGTAGG + Intergenic
928263111 2:29785690-29785712 TTGAAAATGAATCCTGCAGTGGG + Intronic
929413857 2:41727408-41727430 GCTGAATTTCATCATGCAGTGGG + Intergenic
930744572 2:54868822-54868844 GAGGAATGGCTTTCTGCAGTGGG + Intronic
936252215 2:110875675-110875697 GTGGAATTGCATCCTGCAGTGGG + Intronic
940064677 2:149614095-149614117 GTAGAATTGCATTCTGTAGTAGG + Intergenic
943783594 2:191851296-191851318 GAGTCATTGAATCCTGCAGTGGG + Intergenic
945363555 2:208922973-208922995 GTGGAATTGCATTCTCGATTTGG + Intergenic
947957239 2:234202603-234202625 TTACCATTGCATCCTGCAGTTGG - Intergenic
1169522797 20:6391218-6391240 GTGTAATTCCATCTTGCACTTGG + Intergenic
1170489475 20:16858048-16858070 GTGGAATTGCCTCCAGAGGTGGG - Intergenic
1170536265 20:17344006-17344028 GTGGCTTTTCATCCTGCAGTGGG - Intronic
1178179076 21:30139015-30139037 GTGTAATAGCATCTTGCACTGGG + Intergenic
1183322978 22:37176387-37176409 GTGGAGTTGCAGCCTGGAGGTGG - Intergenic
1183465550 22:37978502-37978524 GTGGAATTGGCTACTTCAGTGGG + Intronic
1183500394 22:38175327-38175349 CTGGATTTGCATCGTACAGTGGG - Intronic
951631018 3:24720431-24720453 GTGGATTTGGATTCTGTAGTTGG + Intergenic
952307058 3:32155729-32155751 GTGCAATTGTAGCCTGCACTGGG - Intronic
954756656 3:52844024-52844046 GTGGACTTGCAAAGTGCAGTGGG + Intronic
954938488 3:54349040-54349062 TTTGATTAGCATCCTGCAGTAGG + Intronic
955611342 3:60760465-60760487 GTGGAGTAGGGTCCTGCAGTAGG + Intronic
962021074 3:131502659-131502681 GTGGAATGGCCTGGTGCAGTTGG - Intronic
967359456 3:188613018-188613040 GTGAATTTGCATGCTACAGTGGG + Intronic
968635175 4:1674762-1674784 GTGGAATCGCATCCCCCAGGAGG - Intronic
969638968 4:8385528-8385550 GTGCTGTTGCTTCCTGCAGTGGG - Intronic
970871287 4:20819806-20819828 TTGGAAGTGCATCCTCCAGAAGG - Intronic
975059014 4:69973999-69974021 ATGGAATTGCATCCTTGATTTGG + Intergenic
983034660 4:162848699-162848721 GTAGAACTACATCCTGCATTGGG - Intergenic
991530745 5:67611186-67611208 GTGGAACTAGATCTTGCAGTTGG + Intergenic
992900808 5:81293185-81293207 GTGGGATTGCATTCTCGAGTTGG - Intergenic
993579243 5:89639122-89639144 GTGGGACTGCATCCTGCCCTGGG + Intergenic
997803627 5:136891367-136891389 CTAGAATTGCATCCTCTAGTGGG - Intergenic
1003011439 6:2431000-2431022 TTGGATTTGCATCCTGCCTTGGG + Intergenic
1003146567 6:3514971-3514993 GGGGAATTGGATCCTGGAGCAGG + Intergenic
1006013062 6:31058272-31058294 GTGGATTTGCATCTTGGAGCAGG - Intergenic
1006409384 6:33863500-33863522 GTGGACTTACATCCTCCTGTGGG + Intergenic
1006409436 6:33863723-33863745 CTTGAGTTGCCTCCTGCAGTGGG - Intergenic
1009458198 6:63881248-63881270 TAGGAATTGCTTCCTGCAGATGG - Intronic
1009894834 6:69735227-69735249 GTGTGAGTGCACCCTGCAGTTGG - Intronic
1011438196 6:87360926-87360948 GTGGAATTGAAGCCAGGAGTGGG - Intronic
1013922635 6:115426757-115426779 TTGGATTTACATCCTGAAGTGGG - Intergenic
1014402511 6:121008281-121008303 TTGGAATTGTATCCTTGAGTAGG + Intergenic
1014525748 6:122499921-122499943 ATGGAATTGCATTCTTGAGTTGG - Intronic
1019769917 7:2877074-2877096 CTGGAATTGCATCCTGGTGCAGG + Intergenic
1020960413 7:14795632-14795654 GAGTAATTGGATCCTGGAGTGGG + Intronic
1022679140 7:32527682-32527704 GTGGCATAGCAGCCTGCCGTGGG - Intronic
1032614949 7:133458283-133458305 GAGGGCTTGCATCCTGCAATAGG - Intronic
1034002831 7:147435226-147435248 GTAGATTTCCAACCTGCAGTGGG - Intronic
1035709861 8:1705055-1705077 GTGAAATTCCATCCTGGACTCGG - Exonic
1040957803 8:52997205-52997227 TTGGACTAGCATCCTGCAGTGGG - Intergenic
1042380898 8:68113007-68113029 CTGGAATTGCATGCTGCTGAAGG + Intronic
1047217052 8:122884713-122884735 GTGGAAATGCAGGGTGCAGTGGG + Intronic
1047236796 8:123048725-123048747 GTGGGATTGCAGACTGCAGAGGG - Intronic
1047511317 8:125517925-125517947 GTAGACTTGCATCCTGCCGTCGG + Intergenic
1048604438 8:135952951-135952973 TTGGATTTGCATTCTGCAGCTGG - Intergenic
1052369891 9:27652073-27652095 ATGGAATTGCTTCCACCAGTAGG + Intergenic
1053512278 9:38698346-38698368 GTTGAATTGCAACCACCAGTTGG + Intergenic
1055218109 9:73892334-73892356 GTGGTATCTCATCCTCCAGTAGG - Intergenic
1056045288 9:82708462-82708484 GTGGGATTGCATCCTACTATAGG + Intergenic
1057921460 9:99101422-99101444 GTGGATTTTCATCCTCCAGCAGG - Intergenic
1058371793 9:104277364-104277386 GTGGATTTGCCTCCTGCAGGAGG - Intergenic
1060152468 9:121297623-121297645 GTGCAATTGCTTTCTGCACTTGG + Intronic
1185891073 X:3822535-3822557 GTTGAATGGCAGCCTGCACTAGG + Intronic
1185896177 X:3860951-3860973 GTTGAATGGCAGCCTGCACTAGG + Intergenic
1185901296 X:3899377-3899399 GTTGAATGGCAGCCTGCACTAGG + Intergenic
1185906405 X:3937809-3937831 GTTGAATGGCAGCCTGCACTAGG + Intergenic
1187419188 X:19120736-19120758 ATGGACATGCATCCTGCACTTGG - Intronic
1189585273 X:42454433-42454455 GTTGAATTTCATTCTGCAGGTGG + Intergenic
1190182126 X:48201675-48201697 TTGGAAATGCATGCTGAAGTTGG - Intronic
1190195259 X:48312388-48312410 TTGGAAATGCATGCTGAAGTTGG - Intergenic
1190661701 X:52660610-52660632 TTGGAAATGCATGCTGAAGTTGG - Intronic
1200300576 X:154970599-154970621 GTGGAATGACAGCCTCCAGTGGG - Intronic
1201266554 Y:12212459-12212481 CAGGAAGTGCATCCTGCACTGGG - Intergenic
1201712755 Y:17010510-17010532 CAAGAATTGCATCCTGCACTAGG - Intergenic