ID: 936256801

View in Genome Browser
Species Human (GRCh38)
Location 2:110923035-110923057
Sequence TCTCCCTACATCACAGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936256791_936256801 29 Left 936256791 2:110922983-110923005 CCATTATAGCTCTGCAGCTTCTT 0: 1
1: 0
2: 1
3: 16
4: 209
Right 936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 101
936256793_936256801 0 Left 936256793 2:110923012-110923034 CCTCCTGCTTCTTTCATTCCCGG 0: 1
1: 0
2: 0
3: 20
4: 227
Right 936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 101
936256795_936256801 -3 Left 936256795 2:110923015-110923037 CCTGCTTCTTTCATTCCCGGTCT 0: 1
1: 0
2: 0
3: 17
4: 229
Right 936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 101
936256792_936256801 5 Left 936256792 2:110923007-110923029 CCTTTCCTCCTGCTTCTTTCATT 0: 1
1: 1
2: 5
3: 165
4: 1554
Right 936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 101
936256790_936256801 30 Left 936256790 2:110922982-110923004 CCCATTATAGCTCTGCAGCTTCT 0: 1
1: 0
2: 1
3: 21
4: 258
Right 936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936256801 Original CRISPR TCTCCCTACATCACAGTAGG GGG Intronic
901064420 1:6488127-6488149 TCTGCCTACAGGACAGTATGGGG - Intronic
902216203 1:14935907-14935929 TCTCCCAACATCCCAGGTGGTGG + Intronic
902575935 1:17377593-17377615 AGTCCCTCCATCACAGTAGGCGG + Intronic
903113724 1:21160825-21160847 TCTCCTTCCAGCACAGTACGAGG + Intronic
906762860 1:48393254-48393276 TCTCAGTGCATCACACTAGGAGG - Intronic
909459384 1:75892786-75892808 TGTCCCTAGATCACAGCAGGGGG + Intronic
916334133 1:163650864-163650886 TCTCACATCATCACAGCAGGAGG + Intergenic
921753746 1:218828004-218828026 TCTCCCTACATCCCAGCAAAGGG - Intergenic
923821926 1:237454280-237454302 TCTCCCTACATCACTGTAAAAGG - Intronic
1065479494 10:26178023-26178045 TCTCTCTTCTTCACAGCAGGAGG - Intronic
1067202339 10:44184413-44184435 TCTTCCAATGTCACAGTAGGTGG + Intergenic
1069795022 10:71046459-71046481 TCTCCCTTCATCCCATTATGGGG + Intergenic
1070063339 10:73007880-73007902 TTTCACTACATCTCAGTTGGTGG - Exonic
1070660263 10:78300624-78300646 TCTCCCTCCAACACAGCAAGAGG - Intergenic
1074205501 10:111279572-111279594 TCCCCCTACATGAGAGCAGGAGG + Intergenic
1075475791 10:122732294-122732316 TCTCTCAACATCACTGGAGGTGG - Intergenic
1078747621 11:14130226-14130248 TCTCCCTACATCCCACTGTGAGG + Intronic
1078747703 11:14131190-14131212 TCTCCCTACATCCCACTGTGAGG - Intronic
1086617661 11:88841912-88841934 TCTGCTTAAATCACAGTATGAGG - Intronic
1087275183 11:96154089-96154111 TCTTCCTACATTAGAGAAGGAGG + Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1096145563 12:49276444-49276466 TCTCCCTCCAACGCAGGAGGGGG - Intergenic
1099834934 12:87897000-87897022 TCTCCCTACAGTGCAGTTGGGGG + Intergenic
1101563951 12:105887349-105887371 TCTCCCTGCATCACATCAGGGGG - Intergenic
1102282162 12:111626996-111627018 TCTCCCTAGATCACAGAACCAGG + Intergenic
1102376508 12:112426059-112426081 TTTCCCCACATCACTGGAGGAGG + Intronic
1104166504 12:126235775-126235797 TCTCCCAAAAACACAGTGGGAGG - Intergenic
1105624129 13:22096796-22096818 TCTCCCTACATCAAATTATGAGG + Intergenic
1106069938 13:26400536-26400558 ACTTCCTACATCAGAGTAAGTGG + Exonic
1108305872 13:49132023-49132045 CGTCCCTTCATCTCAGTAGGTGG + Intronic
1108317852 13:49255298-49255320 TCTCCCTATGTCAAGGTAGGTGG + Intronic
1109077381 13:57853653-57853675 TCACCGTAAATCACAGTAGGAGG - Intergenic
1109814056 13:67556071-67556093 TCTCCCTACACTGCAGTAGTTGG - Intergenic
1111023661 13:82489733-82489755 CCTCCATACGTCACAGTAGCTGG - Intergenic
1111773685 13:92631543-92631565 TCTCTGTACATCAAAGGAGGGGG + Intronic
1112077321 13:95928615-95928637 GCTCCCCACATCCCAGAAGGTGG + Intronic
1112504375 13:99967331-99967353 TCTTTATACATCACTGTAGGAGG - Intronic
1115829257 14:37316526-37316548 TCTGCCTACATTACAGGAGGGGG - Intronic
1116856014 14:49953010-49953032 TCTCTCTACATCAAATTAGTTGG - Intergenic
1120935438 14:89891601-89891623 TCTCCCTAATTCACTGTATGAGG + Intronic
1121362797 14:93277392-93277414 TCCCCCTGCATTACAGTAGAGGG - Intronic
1121713572 14:96056860-96056882 TTGCCATACATCACAGAAGGAGG - Intronic
1126451412 15:48812767-48812789 TCTCACTACAACACTGTGGGGGG + Intergenic
1132770192 16:1557903-1557925 TCTCCCAACATCCCAGTGGTCGG + Intronic
1134075871 16:11290902-11290924 TCTCCATACATTAGAGTTGGTGG - Intronic
1141953673 16:87355695-87355717 TGGCGCTACATCACAATAGGAGG + Intronic
1150226987 17:63529649-63529671 CCTCCCTGCATCACAGGAGCAGG + Intronic
1159497674 18:69226955-69226977 CCTCCCTGCTTCACTGTAGGTGG + Intergenic
1162852625 19:13442438-13442460 TCTCTCTACATCTCTGTTGGAGG - Intronic
1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG + Intronic
931560185 2:63553113-63553135 TCTCCCCACACCACTGTAAGGGG + Intronic
931632289 2:64312065-64312087 TCTCACTACTTCACAGCGGGTGG - Intergenic
933765856 2:85708815-85708837 TCTCAGTACATCACAGCAGGAGG - Intergenic
935838281 2:107078839-107078861 CCTGCCTACCTCTCAGTAGGTGG - Intergenic
936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG + Intronic
938760134 2:134417617-134417639 TCTCAGCACATCACATTAGGGGG + Intronic
940830533 2:158459996-158460018 TCTCCTTACATAATAGTAGGGGG - Intronic
941150174 2:161904971-161904993 TCTCCCAACATCACTTTTGGAGG + Intronic
944132187 2:196358497-196358519 TCTCCCTTGAACACAGGAGGCGG + Intronic
944584372 2:201160630-201160652 TCCCCCTGCATCACATCAGGAGG + Exonic
945401868 2:209392329-209392351 TCTCCCAACTTCGCAATAGGAGG + Intergenic
1173217066 20:41094915-41094937 GCTCCCTGCATCAGAGTAGTGGG - Intronic
1173639512 20:44590873-44590895 TCTCTCTTCAGCACTGTAGGGGG + Intronic
1174699701 20:52595718-52595740 TCTCACTACAACACTGTAAGTGG + Intergenic
1174754948 20:53148934-53148956 CCTCCATAAATCACAGGAGGAGG + Intronic
1175643417 20:60650626-60650648 TCTCACTCCATCTCAGTAGCAGG - Intergenic
1180625341 22:17190358-17190380 TCTCCCTGCATCTCTGTCGGGGG + Intronic
1181823838 22:25497241-25497263 ACTCCCTACAGAACTGTAGGTGG + Intergenic
949418258 3:3836781-3836803 TCTCCCTAGACTACAGTGGGTGG + Intronic
952316181 3:32234470-32234492 TCTCACTACATCATATTAGGAGG + Intergenic
952521905 3:34169375-34169397 TGTCCTTACATAACAGAAGGTGG + Intergenic
952891746 3:38047023-38047045 TCTCACTGCAGCACAGCAGGAGG + Intronic
953036813 3:39219087-39219109 TCTCACTGCATCACACGAGGGGG + Intergenic
954353466 3:50065091-50065113 TCTTCCTTCTTCACAGTAGGAGG - Exonic
959271160 3:104212273-104212295 TCTGCCTACTTCATAATAGGAGG - Intergenic
961156418 3:124683458-124683480 CCTGCCTACATCACAGGATGGGG + Intronic
963961908 3:151318880-151318902 TGTCCCTTCACTACAGTAGGTGG + Intronic
964171003 3:153769060-153769082 TCACCCTACAGGCCAGTAGGTGG - Intergenic
967354604 3:188554231-188554253 TCTCCATGCACCACAGTGGGTGG - Intronic
968288622 3:197522497-197522519 TCTTCCTCCTGCACAGTAGGAGG - Intronic
969506431 4:7591033-7591055 TCTCCCCACAGCACACTTGGCGG + Intronic
980625691 4:135372113-135372135 TCGCCTGACAGCACAGTAGGAGG + Intergenic
983149707 4:164262818-164262840 ACTCCCAATATCACAGAAGGAGG + Intronic
986956857 5:13161503-13161525 TCTCCCTTTATCACAATAGCTGG + Intergenic
992693817 5:79264469-79264491 TCCTCCTACCTCACTGTAGGAGG + Intronic
995168095 5:109071393-109071415 TCTCATTATATCACAGCAGGGGG + Intronic
998918718 5:147043859-147043881 TTTCCCTACATCTCAGAAGCGGG + Intronic
1001963095 5:175892407-175892429 CCTCCCTACAACAGAGTAGGGGG + Intergenic
1002447866 5:179301096-179301118 TTTGCCCAGATCACAGTAGGCGG - Intronic
1007498090 6:42275521-42275543 TGTCCCTACATCACAGTGACTGG - Intronic
1011605671 6:89102878-89102900 TCTCCCTCCCTCCCAGTAGCTGG + Intronic
1012447179 6:99318724-99318746 AATACCTACATCACAGTGGGTGG - Intronic
1013800078 6:113932045-113932067 TCTCCCTACATCCCAGACGATGG - Intergenic
1016401946 6:143690331-143690353 TCTCTCTTCATCACACCAGGGGG + Intronic
1024559799 7:50633093-50633115 TCACCCTACAGGCCAGTAGGTGG - Intronic
1027626882 7:80556224-80556246 TCTCCCTGTATCAAACTAGGAGG + Intronic
1030621572 7:111796156-111796178 TGTCCCTCTATCACAGGAGGCGG + Intronic
1031977244 7:128101870-128101892 TCTTACTACATCAAAGTAGGGGG + Intergenic
1038194113 8:25350961-25350983 TTTCCCTCCAACACAGAAGGTGG + Intronic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1040991579 8:53356987-53357009 TCTCATTGCATCACAGCAGGAGG - Intergenic
1042485911 8:69345505-69345527 TCTCCCTAGAAGACAGCAGGAGG + Intergenic
1042491471 8:69403609-69403631 TCTCTCTACATCACAGCAGGAGG + Intergenic
1043755559 8:83999929-83999951 TCACCCTAAAGGACAGTAGGTGG + Intergenic
1043814255 8:84782390-84782412 TCTCCCTACCTCAAAGAAAGAGG - Intronic
1045777957 8:105828560-105828582 ATTGCCTACCTCACAGTAGGAGG - Intergenic
1050025973 9:1334952-1334974 ATTCCCTACATCACACTGGGGGG + Intergenic
1052789872 9:32865351-32865373 TTACCCTGCATCACAGTGGGTGG - Intergenic
1059661085 9:116400934-116400956 TATACCTACCTCACAGTGGGAGG + Exonic
1060428547 9:123527028-123527050 TCTCCCTTCATCCTAGTGGGTGG + Intronic
1062537149 9:137026033-137026055 TCTCCCCCCGACACAGTAGGCGG - Intronic
1187574021 X:20534785-20534807 ACTCTCTAAATCACAGGAGGTGG + Intergenic
1188635161 X:32420903-32420925 TGAGCCTACATCACAGTAGAAGG - Intronic
1191177939 X:57525708-57525730 TCTCCCTACTTCACTCTATGAGG - Intergenic
1198979977 X:142384089-142384111 TCTCTCTTCATCTCAGTAAGCGG - Intergenic
1199912928 X:152307522-152307544 TCTCCCTACATCATATTGGCTGG - Intronic