ID: 936258267

View in Genome Browser
Species Human (GRCh38)
Location 2:110935420-110935442
Sequence CTGGGAGGCCGTATTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 131}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936258266_936258267 -9 Left 936258266 2:110935406-110935428 CCTCAGTGCTTGTTCTGGGAGGC 0: 1
1: 0
2: 1
3: 25
4: 208
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258262_936258267 -4 Left 936258262 2:110935401-110935423 CCTGGCCTCAGTGCTTGTTCTGG 0: 1
1: 0
2: 1
3: 39
4: 324
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258256_936258267 16 Left 936258256 2:110935381-110935403 CCTAACCCTCATCCCTTCGTCCT 0: 1
1: 0
2: 0
3: 23
4: 302
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258259_936258267 10 Left 936258259 2:110935387-110935409 CCTCATCCCTTCGTCCTGGCCTC 0: 1
1: 0
2: 1
3: 36
4: 450
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258253_936258267 29 Left 936258253 2:110935368-110935390 CCCCTCTTGTCATCCTAACCCTC 0: 1
1: 0
2: 2
3: 20
4: 246
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258261_936258267 3 Left 936258261 2:110935394-110935416 CCTTCGTCCTGGCCTCAGTGCTT 0: 1
1: 0
2: 1
3: 29
4: 216
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258260_936258267 4 Left 936258260 2:110935393-110935415 CCCTTCGTCCTGGCCTCAGTGCT 0: 1
1: 0
2: 1
3: 20
4: 196
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258258_936258267 11 Left 936258258 2:110935386-110935408 CCCTCATCCCTTCGTCCTGGCCT 0: 1
1: 0
2: 1
3: 37
4: 461
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258254_936258267 28 Left 936258254 2:110935369-110935391 CCCTCTTGTCATCCTAACCCTCA 0: 1
1: 0
2: 1
3: 25
4: 233
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
936258255_936258267 27 Left 936258255 2:110935370-110935392 CCTCTTGTCATCCTAACCCTCAT 0: 1
1: 0
2: 0
3: 16
4: 185
Right 936258267 2:110935420-110935442 CTGGGAGGCCGTATTTCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936258267 Original CRISPR CTGGGAGGCCGTATTTCCCC AGG Intronic