ID: 936259836

View in Genome Browser
Species Human (GRCh38)
Location 2:110949235-110949257
Sequence CCTCCCAAGAAGGATCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936259830_936259836 12 Left 936259830 2:110949200-110949222 CCATACTCAGAGGGTCCAAGGCT 0: 1
1: 0
2: 0
3: 9
4: 145
Right 936259836 2:110949235-110949257 CCTCCCAAGAAGGATCTGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 122
936259833_936259836 -3 Left 936259833 2:110949215-110949237 CCAAGGCTGGATCTGGCAAACCT 0: 1
1: 0
2: 2
3: 24
4: 159
Right 936259836 2:110949235-110949257 CCTCCCAAGAAGGATCTGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936259836 Original CRISPR CCTCCCAAGAAGGATCTGTC TGG Intronic
900673587 1:3870441-3870463 TCACCCCAGAAGGATCTGCCTGG - Intronic
904383546 1:30127247-30127269 CCTCCAAAGAAGGACTTCTCAGG + Intergenic
904578312 1:31520821-31520843 CCTTCCTAGAAGATTCTGTCTGG - Intergenic
907251992 1:53145784-53145806 CCTCCCCAGAAGCATCTCTGAGG - Intergenic
909631369 1:77772739-77772761 CCTCCCAGGAATGATATGTCAGG - Intergenic
910609318 1:89124318-89124340 CCTCTCCAGAAGGATGTATCAGG + Intronic
910653073 1:89590886-89590908 CCTCCCAAGAGACATTTGTCTGG + Intronic
913192543 1:116425987-116426009 CTTCACAAGAAGGATCAGGCAGG - Intergenic
915309667 1:155000831-155000853 CCTCCGGACCAGGATCTGTCCGG + Intergenic
915523234 1:156460728-156460750 CATACCACAAAGGATCTGTCAGG + Intergenic
916701634 1:167301715-167301737 CCTCCCAACCAGGAACTGTAAGG - Intronic
916852102 1:168714043-168714065 CCCGCCAAGAGGGATCTTTCAGG - Intronic
924179815 1:241429447-241429469 CCTCTCAAGAAGTATCTTTGTGG + Intergenic
1063953838 10:11247729-11247751 CCTCCCAGCATGCATCTGTCTGG - Intronic
1069038650 10:63671770-63671792 TCTCCCAAGAAGGCTCTGAAAGG - Intergenic
1076606841 10:131694861-131694883 CTTCCCCAGAAGGAGCTGTGTGG + Intergenic
1085235601 11:75012711-75012733 TTTCCCAAGACTGATCTGTCTGG + Intronic
1088626804 11:111735542-111735564 CCACCCAGGCAGGATCTGCCAGG - Intronic
1088658685 11:112025808-112025830 CCTCTCAAGGAGGATCTTGCAGG - Intronic
1095885254 12:47182154-47182176 CCTCACTAGAAGGATCTCCCAGG - Intronic
1096550036 12:52366095-52366117 CCTCCCAAGAAAGTTTTGTCGGG - Intronic
1098487361 12:71036946-71036968 CATCCCATGAAGGATCTGATAGG - Intergenic
1098575429 12:72036581-72036603 CTTTCCAAGAAGGATGGGTCTGG + Intronic
1101317844 12:103645780-103645802 CCTCACAACAAAGAACTGTCTGG - Intronic
1103907372 12:124334658-124334680 CACCCCCAGAAGGTTCTGTCAGG - Intronic
1104087794 12:125492457-125492479 CATCCCAGGAAGGAGCAGTCGGG - Intronic
1104377909 12:128281339-128281361 CCTCCCAAACAGGACCTGTCTGG - Intronic
1108765484 13:53623716-53623738 CTTCCCCAGAAGAGTCTGTCAGG - Intergenic
1110744511 13:79037269-79037291 CCTCCCAGGTAGGAGCTCTCTGG + Intergenic
1112431721 13:99355919-99355941 CCTCCCCAGATGGAACTGGCTGG + Intronic
1113102275 13:106733561-106733583 CCTCCCCAGGAAGATCTGTTGGG + Intergenic
1119165876 14:72492402-72492424 CCTCCCAGGTAGGACCTCTCTGG + Intronic
1121907215 14:97757502-97757524 CCTCCAAGGAAGGATCTGACGGG - Intronic
1123159063 14:106260026-106260048 CCTCCCGAGATGGTTCTGTGTGG + Intergenic
1123160181 14:106270863-106270885 CCTCCCGAGACGGTTCTGTGTGG + Intergenic
1123207808 14:106730402-106730424 CCTCCCGAGATGGTTCTGTGTGG + Intergenic
1123212831 14:106777408-106777430 CCTCCCGAGATGGTTCTGTGTGG + Intergenic
1127182107 15:56432211-56432233 TTTCCTAAGAAGGATCTGGCAGG + Intronic
1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG + Exonic
1137745335 16:50816279-50816301 CCTCCCAAGGATGAGCTGTCAGG + Intergenic
1138627354 16:58263050-58263072 CCTCCCAAAAGGGTTCTGTTTGG - Intronic
1139330757 16:66188042-66188064 CTTCCCAAGAAGGCTCCATCTGG - Intergenic
1142215627 16:88828474-88828496 CCTGCCCAGAGGGAACTGTCGGG + Intronic
1148123770 17:45226484-45226506 CCTCCAAAGAAGGAGCAGCCGGG - Intronic
1151404282 17:73876679-73876701 CCTCCCCAGCAGGGTCTGTTAGG - Intergenic
1151669906 17:75566300-75566322 CTGCTCCAGAAGGATCTGTCTGG + Intronic
1152371330 17:79890523-79890545 CTTTCCAGGAAGGATCTGTGGGG + Intergenic
1153227451 18:2909461-2909483 CCTCCTAACAAGAGTCTGTCCGG + Intronic
1161702751 19:5804372-5804394 CCTCCCAAGAAAGCTCTTCCAGG - Intergenic
1162585256 19:11554295-11554317 CCTCCCAAGAAGAAGATGACAGG - Exonic
1162851641 19:13435595-13435617 CCTACCAAGAAAGATGTGCCTGG + Intronic
1164858721 19:31545607-31545629 CTTCCCATGAAAGATCTTTCGGG + Intergenic
925680153 2:6411885-6411907 CCTCCCAAGCAGGAACAGCCAGG - Intergenic
926132176 2:10310563-10310585 CCTTCTGAGAAGCATCTGTCAGG + Intronic
926230867 2:11002914-11002936 CTTCTCAAGAAGGAACTGACGGG + Intergenic
927039568 2:19214644-19214666 CCTCCCATTAATGATCTTTCTGG - Intergenic
931489889 2:62733783-62733805 CCTCCCAAGACTGATCTTCCTGG + Intronic
933689055 2:85165393-85165415 CTTCCCAAGAAGGATCTAACAGG - Intronic
934097117 2:88616968-88616990 CCTCCCCAGAAGCATGTCTCTGG + Intronic
934963383 2:98697574-98697596 TATCCCAAGAAGTAACTGTCAGG + Intronic
936259836 2:110949235-110949257 CCTCCCAAGAAGGATCTGTCTGG + Intronic
937916647 2:127102570-127102592 CCTCCCAAGTAGGCTGTGCCTGG + Intronic
940135362 2:150429590-150429612 CCTCCCAATAGGGATTTGGCTGG + Intergenic
940811273 2:158245375-158245397 CCTCCCCAGAAAGATCTCTAAGG + Intronic
942075352 2:172352288-172352310 TCTCCCAGGAAAGATGTGTCAGG + Intergenic
946567395 2:220981982-220982004 ACTCCCAAGATGGCTCTGTGTGG + Intergenic
948689970 2:239695674-239695696 CTTCCCAAGAAGGAGCATTCCGG - Intergenic
1169264893 20:4161731-4161753 CCTCCCCTTAAGGATCTGTCAGG - Intronic
1171364530 20:24614689-24614711 ACTTCCAAAAAGGATCTGTGTGG - Intronic
1173472095 20:43332156-43332178 CTTCCCAAGAAGGATCTGGTGGG + Intergenic
1175361957 20:58419087-58419109 CCATCCAAGAAGGAGCTGTGGGG + Intronic
1178826097 21:36018106-36018128 CTTCCCTCGAAGGATCAGTCTGG + Intergenic
1180067090 21:45417957-45417979 CCTCCCAGGAAAGACGTGTCTGG - Intronic
1180922298 22:19527200-19527222 CCTGCCCAGAAGGAGCTGACAGG + Exonic
1183689233 22:39378943-39378965 TCTCCCTAGAAGGATCAGTAGGG + Intronic
1184244425 22:43228728-43228750 CCTCCCTGGAACGAGCTGTCTGG + Intronic
1184326352 22:43790245-43790267 CAGCCCAAGAAGGATGTGTGTGG - Intronic
1185001000 22:48245653-48245675 CCGCCCTAGAAGAAACTGTCGGG - Intergenic
949646115 3:6096296-6096318 CCACCCCAGAAGAATCTGTGAGG + Intergenic
950701622 3:14754239-14754261 CCTCCTGGGAAGCATCTGTCAGG - Intronic
951106262 3:18746828-18746850 CTTCCCAAGATGGATCTTCCTGG - Intergenic
951283315 3:20779452-20779474 CCTCCTAAGAAGGAGCTCCCAGG + Intergenic
951505664 3:23442356-23442378 CCCCCCAAAAAGGACTTGTCTGG + Intronic
953154283 3:40354878-40354900 CCTCCCACGAAGCATCTACCTGG + Intergenic
953473247 3:43184475-43184497 CCTCCCTAGAAGGAGCTCTTCGG - Intergenic
956740204 3:72269752-72269774 CCTTCCAGGAAGCATCTATCGGG - Intergenic
962085868 3:132190893-132190915 GCTCCCAGCCAGGATCTGTCTGG - Intronic
967769154 3:193314726-193314748 CCTCCCAGCCAGGATCTGTGCGG - Intronic
971489793 4:27199351-27199373 CCTCCAAAGGAGTAACTGTCAGG - Intergenic
975020987 4:69488492-69488514 CATTACAAGAAGGATATGTCAGG + Intronic
976809800 4:89088853-89088875 CCTCTCAAGAAGTATCTTTGTGG + Intronic
981788698 4:148510484-148510506 CATCCCCAGAAGGCTCTGCCTGG + Intergenic
985546751 5:513781-513803 CTTCCTGAGAAGGAGCTGTCAGG - Intronic
985604496 5:851136-851158 CCTCTCAGGGAGGATCTGGCAGG - Intronic
990159138 5:52917151-52917173 ACTCCCAAGAAAGATCTGGCTGG + Intronic
991979189 5:72214061-72214083 CCTCACAACAAGGAGCTATCTGG - Intergenic
995853746 5:116573136-116573158 CCGCCCCAGAAGGATCAGGCAGG + Intronic
999265141 5:150262085-150262107 TCTCCCAAGAAGGATCTGGGAGG + Intronic
999910301 5:156190359-156190381 CCACCAAAAAAGGATCTGCCCGG + Intronic
1001685633 5:173592975-173592997 TCTACCCAGATGGATCTGTCAGG - Intergenic
1004190167 6:13456758-13456780 GCTCCCAAGACAGATCTGTGCGG - Intronic
1006072736 6:31508872-31508894 CCTCTCCAGAAGGGTCTGTGTGG + Intronic
1006192728 6:32219628-32219650 CCACCCAGGAAGCACCTGTCTGG - Exonic
1006814421 6:36840453-36840475 CCTCCCCAGAAGGAGATGTAGGG - Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013596361 6:111664283-111664305 CGCACCCAGAAGGATCTGTCAGG - Intronic
1014211235 6:118710359-118710381 CAGCTCAAGAAGTATCTGTCAGG + Intergenic
1016272339 6:142302693-142302715 CCTGCCAAGAAGGCGCTCTCCGG + Intronic
1018376990 6:163222321-163222343 CATCCAAAGAAGGATGTGTGAGG + Intronic
1020002327 7:4762903-4762925 CTTCCCAACAGGCATCTGTCCGG - Exonic
1026190896 7:68125743-68125765 CCTCCCATGAAGTATGTGTTTGG - Intergenic
1027235883 7:76297631-76297653 CCACCCCAGAGGGAGCTGTCAGG - Intergenic
1027498160 7:78913924-78913946 CCTCCCAATAAGAATCTCTGAGG + Intronic
1029112974 7:98222954-98222976 CATTTCAAGAAGAATCTGTCTGG + Intronic
1029382898 7:100225081-100225103 CCTCCCAGGAAGGCTCTGGGTGG + Intronic
1035954542 8:4061618-4061640 CCTCCCTTGCAGAATCTGTCTGG - Intronic
1039142321 8:34403648-34403670 CTACCCAGGAGGGATCTGTCAGG + Intergenic
1041185744 8:55299188-55299210 ACTCTCAAGATGGATTTGTCTGG + Intronic
1041701358 8:60792608-60792630 CTTCCCAAGAATGAACTGTATGG - Intronic
1049599427 8:143500133-143500155 CCACCCAGGATGGATCTGTGTGG - Intronic
1050171493 9:2824106-2824128 CCTTGGAAGAAGGATCTGTCTGG - Intronic
1052260648 9:26512670-26512692 CCTCCAAGCAAGGATTTGTCTGG - Intergenic
1052796952 9:32931571-32931593 CCTCCCAGGAGGGATCTGGGCGG - Intergenic
1053392096 9:37743138-37743160 CATCCCAGGATGGATCTTTCTGG - Intronic
1054891753 9:70259138-70259160 CCTCCGACGAAGGGTCTCTCGGG - Exonic
1055100250 9:72456775-72456797 CCACCCCAGAAGGATCAGACTGG - Intergenic
1056813998 9:89787311-89787333 CCTCCCAATGAGAATTTGTCAGG - Intergenic
1057760179 9:97866803-97866825 CCTCCCAACAAAGATAAGTCTGG - Intergenic
1060258113 9:122050496-122050518 TCTCCCCTGAAGCATCTGTCAGG - Intronic
1062057734 9:134477236-134477258 CTTCCCAAGAGTGATCGGTCCGG - Intergenic
1062113243 9:134794000-134794022 CCGCCCAAGGTGGATCTGTATGG - Intronic
1188223609 X:27570510-27570532 CCTCCCATGCAGTTTCTGTCTGG + Intergenic
1198528556 X:137526298-137526320 CCTCTCAAGAAAGGTCTATCTGG + Intergenic
1198967359 X:142241839-142241861 CCTCCCAAGAAGAAAATCTCTGG + Intergenic
1200840441 Y:7776222-7776244 CCTCAGAAGAAGGATATGTCCGG - Intergenic