ID: 936260827

View in Genome Browser
Species Human (GRCh38)
Location 2:110958657-110958679
Sequence TCCCATGGGCAGCAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936260821_936260827 -5 Left 936260821 2:110958639-110958661 CCCCAGGGCACTGAGGGATCCCA 0: 1
1: 0
2: 2
3: 18
4: 260
Right 936260827 2:110958657-110958679 TCCCATGGGCAGCAGATGGAAGG 0: 1
1: 0
2: 1
3: 30
4: 269
936260823_936260827 -7 Left 936260823 2:110958641-110958663 CCAGGGCACTGAGGGATCCCATG 0: 1
1: 0
2: 0
3: 19
4: 209
Right 936260827 2:110958657-110958679 TCCCATGGGCAGCAGATGGAAGG 0: 1
1: 0
2: 1
3: 30
4: 269
936260822_936260827 -6 Left 936260822 2:110958640-110958662 CCCAGGGCACTGAGGGATCCCAT 0: 1
1: 0
2: 0
3: 22
4: 146
Right 936260827 2:110958657-110958679 TCCCATGGGCAGCAGATGGAAGG 0: 1
1: 0
2: 1
3: 30
4: 269
936260819_936260827 1 Left 936260819 2:110958633-110958655 CCAAATCCCCAGGGCACTGAGGG 0: 1
1: 0
2: 5
3: 20
4: 298
Right 936260827 2:110958657-110958679 TCCCATGGGCAGCAGATGGAAGG 0: 1
1: 0
2: 1
3: 30
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936260827 Original CRISPR TCCCATGGGCAGCAGATGGA AGG Intronic
900362121 1:2294170-2294192 CCCCATGGGCACCAGTGGGAGGG - Intronic
900593780 1:3471383-3471405 CCCCACAGGCAGCAGATGGGTGG - Intronic
901458812 1:9379175-9379197 TCCTATGGGCAGCACCTTGAAGG + Intergenic
902676585 1:18012899-18012921 CACCATGGACAGCAGATGGGGGG + Intergenic
903473068 1:23600745-23600767 TCACAGGAGCTGCAGATGGATGG - Intronic
903650202 1:24917340-24917362 TCTCATGGGCAGCAGCTGGGTGG - Intronic
903813827 1:26050084-26050106 TCCCAAGGCCAACAGAGGGAAGG - Intergenic
903996368 1:27307555-27307577 CCCCAGGGGCTGCAGCTGGAGGG - Exonic
904279078 1:29405752-29405774 TACAATGGCCAGCAGATGGATGG + Intergenic
904586886 1:31585614-31585636 TCCCACAGGCAGCACCTGGAGGG + Intronic
904663765 1:32104386-32104408 TCCTATGGGCATAGGATGGAGGG + Intergenic
905479477 1:38251214-38251236 TCCCCTGGGCAGCACCTTGATGG - Intergenic
907447302 1:54516714-54516736 TCCCAACTGCAGCAGAGGGAGGG + Intergenic
910244389 1:85123026-85123048 TCCCACTGGCAACAAATGGAAGG + Intronic
914247329 1:145896024-145896046 CCCCATGGGCCACAGCTGGAAGG + Exonic
914357628 1:146900760-146900782 TCCCAAAGGAAGCAGAAGGAAGG - Intergenic
915929238 1:160048506-160048528 TCCCAGGGGCAGCAGGTGCAGGG + Intronic
917319182 1:173760969-173760991 TCCCAAAGGCAGCAGATGGTTGG - Intronic
918014523 1:180620174-180620196 TCCCAATGGCAGAAGGTGGAAGG - Intergenic
918094663 1:181324923-181324945 TCCCAGATGCAGGAGATGGAAGG - Intergenic
919865054 1:201775124-201775146 CCCCTTTGGGAGCAGATGGAGGG - Intronic
921452777 1:215328956-215328978 ACCCAAAGCCAGCAGATGGATGG + Intergenic
921584404 1:216930487-216930509 ACCCATGGGCAGCAGAGGCAAGG - Intronic
922153197 1:223022354-223022376 CTCCCTGGGCAGCAGAAGGAAGG + Intergenic
923211641 1:231808832-231808854 TCCCCTGGTCTTCAGATGGAAGG + Intronic
923706529 1:236348755-236348777 TTCATTGGGCAGCACATGGACGG - Intronic
923996472 1:239500857-239500879 TCCTAAAGGCAGCAGATGGTTGG - Intronic
1063227991 10:4034139-4034161 TCCCCTGGACAGCAGTTTGAAGG + Intergenic
1063428023 10:5964932-5964954 TCACACAGGCAGCAGAGGGAAGG - Intronic
1065046792 10:21752810-21752832 CCCCACGGGCAGGAGATGGAAGG + Intergenic
1067179240 10:43972335-43972357 ACCGAGGGGAAGCAGATGGAGGG + Intergenic
1069855724 10:71439924-71439946 TCCCATGGGCAGCCTCTGCACGG + Intronic
1070223595 10:74476800-74476822 TCCCATGGTTGGCAGGTGGAAGG - Intronic
1072728884 10:97831518-97831540 TCTCATTAGGAGCAGATGGAGGG + Intergenic
1073994414 10:109299327-109299349 TGCCATGAGCTGCAGATGCAGGG + Intergenic
1075207927 10:120462772-120462794 TCCCAAAGGCAGCGGATGGAAGG - Intronic
1076227833 10:128794449-128794471 TCCCATGGAAAGCAGAGGAAGGG + Intergenic
1076374408 10:129973428-129973450 TCCCGTGGGCAGGAGATGGCTGG + Intergenic
1076526452 10:131115374-131115396 CCCCAGGGGCAGAAGAGGGAGGG + Intronic
1078966645 11:16352237-16352259 ACCAATGGGCAGATGATGGATGG + Intronic
1081613400 11:44576876-44576898 TCCCGTGGGCAGTTGAGGGATGG + Intronic
1085346961 11:75774483-75774505 TCACATGGGAAGCAGAGGCAGGG - Intronic
1086324314 11:85682745-85682767 TCCCATGGGCAGAGGCCGGACGG - Intronic
1087998157 11:104838270-104838292 TTCCATGGGTAGGAGGTGGAGGG + Intergenic
1088732267 11:112693931-112693953 TCCCATGGGCAGGATATAGCAGG + Intergenic
1089011564 11:115136104-115136126 TCCTGTGGGCAGCACAGGGAAGG - Intergenic
1089730579 11:120516443-120516465 TCCCGTGTGCAGCAGAAGGCTGG + Intronic
1090651155 11:128807293-128807315 TCACATGGTCAACTGATGGAGGG + Intronic
1090707569 11:129352998-129353020 ACCCATAGGCAGCATATGCAGGG - Intergenic
1091646907 12:2280035-2280057 TCTCATAAGCAGCAGATAGATGG + Intronic
1091841956 12:3627818-3627840 TCCCACGAGCTGCACATGGAGGG - Intronic
1092290795 12:7158476-7158498 TCCCATGGACAGGAGAGAGAAGG - Exonic
1092502067 12:9057862-9057884 TCACATAGGGAGCAGTTGGAGGG + Intergenic
1096407295 12:51353130-51353152 TCCCATAGCTAGCAGATGGCTGG - Exonic
1096684175 12:53276956-53276978 TCCCATGGCCACAAGATGAAGGG - Intronic
1101687423 12:107038927-107038949 TCTCTTGGGCAGCAGCTGGGAGG - Intronic
1102907490 12:116688028-116688050 TCTCCTGGGCACCAGAGGGAGGG - Intergenic
1104056752 12:125236623-125236645 TCCCAGGGGCAGCAGTGGGGAGG - Intronic
1104612149 12:130237486-130237508 TCCCATGAGCCGCAGATGGATGG + Intergenic
1105541855 13:21322774-21322796 GGGCATGGGCAGCAGATGGGAGG - Intergenic
1106046716 13:26148835-26148857 TCCAAAGGCCAGCAGATGCAGGG + Intronic
1109459199 13:62632417-62632439 TCCCATGTGCATTGGATGGATGG - Intergenic
1112353159 13:98653583-98653605 TCCCATGGCCAGTAGGTGGCAGG - Intergenic
1113154676 13:107306310-107306332 TCCCATCAGCCGCAGATGGGAGG - Intronic
1113173195 13:107529880-107529902 TCCCATGGCCACTAGATGAAGGG - Intronic
1114570043 14:23660550-23660572 TCACAAGTGCAGCAGATGAAGGG + Intergenic
1114696926 14:24634113-24634135 TGCCCTGGGCAGCAGGAGGAAGG + Exonic
1115440102 14:33424663-33424685 TCCCTTGGACAGCAAAGGGAAGG + Intronic
1115540749 14:34418322-34418344 ACCCATGGTCAGCAGCAGGAAGG + Intronic
1117335939 14:54757635-54757657 TCCCATTGACAGCAGCTGCATGG + Intronic
1118602631 14:67481379-67481401 AGCCATGGGTAGTAGATGGAGGG + Intronic
1120877961 14:89392131-89392153 TCCCATAGGCAGCATTAGGAGGG + Intronic
1121501824 14:94444120-94444142 TCCCATAGGCAGCACTTGGGTGG + Intronic
1122286560 14:100655860-100655882 TCCCCTGGGCTCCAGATGGCAGG + Intergenic
1122411130 14:101526759-101526781 CCCCATGGGTGGCAGGTGGATGG + Intergenic
1123756311 15:23400099-23400121 TACCATGTGCAGCAGAAGGGAGG + Intergenic
1124051288 15:26199352-26199374 CCACATGGGCAGCAGAGGAAGGG - Intergenic
1125487579 15:40123126-40123148 TCCTGTGGGAAGCAGATGGCAGG + Intergenic
1125489393 15:40135932-40135954 TCCTGTGGGAAGCAGATGGCAGG + Intergenic
1127001425 15:54512336-54512358 TTCCATGAGCAGAAGAAGGAAGG + Intronic
1127149265 15:56056764-56056786 TCCCAAGGGGAGGAGATTGAAGG + Intergenic
1128373239 15:67056445-67056467 TCTCATGGGCTGCAGATGCTGGG + Intergenic
1128392823 15:67194369-67194391 TCCCATGGGGAGGTGATGGTGGG + Exonic
1128431517 15:67599638-67599660 TTGCATGGGCAGAAAATGGATGG - Intronic
1129330250 15:74823457-74823479 CCCCAAGGGCAGCACATGGATGG - Intronic
1131135699 15:89933515-89933537 TCCCAGGGGCAGGAGTGGGAGGG + Intergenic
1131505520 15:93014834-93014856 TCCCATGGCCCACAGATGCATGG + Exonic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1133527042 16:6615785-6615807 TGCCATTAACAGCAGATGGATGG + Intronic
1134829910 16:17314522-17314544 TCTCTTGGATAGCAGATGGATGG - Intronic
1135010859 16:18877411-18877433 TGCCATGGGCTTAAGATGGAGGG + Intronic
1136314519 16:29444678-29444700 TGCCATGGGCTTAAGATGGAGGG + Intronic
1136327959 16:29546446-29546468 TGCCATGGGCTTAAGATGGAGGG + Intergenic
1136442646 16:30286447-30286469 TGCCATGGGCTTAAGATGGAGGG + Intergenic
1138295619 16:55882746-55882768 TCCCATGGGCAGAACATGCTAGG - Intronic
1139710840 16:68774709-68774731 GGCCCTGGGCAGCAGCTGGAGGG + Intronic
1139889390 16:70238935-70238957 TGCCATGGGCTTAAGATGGAGGG + Intergenic
1139976554 16:70816535-70816557 TCCCAAAGGAAGCAGAAGGAAGG + Intronic
1140709157 16:77660373-77660395 TCCCATGGGCAGCCAAAGGGTGG - Intergenic
1140842057 16:78849004-78849026 TACCATGAGCAGCAGTAGGATGG + Intronic
1141788892 16:86219584-86219606 TCCCCTGGGCAGCACAGGGTGGG - Intergenic
1143721980 17:8818831-8818853 TCAAATGGTCAGCAGATGGAGGG + Intronic
1144734215 17:17545987-17546009 GCCCAGGGACAGAAGATGGAAGG - Intronic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1146284432 17:31564994-31565016 TCTCCTGGGCAGCAAATGCAAGG - Intergenic
1146432799 17:32813935-32813957 TGCCATGGGCATTAGGTGGAAGG + Intronic
1146746460 17:35334546-35334568 TCCCAAAGGCAGCAGATGGTTGG + Intergenic
1147256193 17:39183908-39183930 TCCCAGGAACAGCAGGTGGAGGG + Intronic
1147381331 17:40057976-40057998 CACTATGGGCAGCAGGTGGATGG + Intronic
1148388993 17:47256552-47256574 TCCCTGGGGAAGCAGATGGTGGG + Intronic
1148463197 17:47849936-47849958 TCCCAGAGGCAGGAGATGGTAGG - Intronic
1148756750 17:49977109-49977131 TCCCAGGGGCAGAAGGTGAATGG - Intergenic
1149644224 17:58228017-58228039 TCACATGGACAGCTGAAGGATGG + Intronic
1150818571 17:68415926-68415948 TCCCGAAGGCAGCAGATGGTTGG + Intronic
1151340778 17:73469438-73469460 GGCCATGAGAAGCAGATGGAAGG - Intronic
1152126036 17:78447463-78447485 TCAGATGGGCAGCAGGTGGCTGG + Intronic
1152318680 17:79595761-79595783 GCCCATGGGCAGCAGATTCTTGG + Intergenic
1152644242 17:81461445-81461467 CCCCATGGGCAGCGGGGGGATGG - Exonic
1152665835 17:81568827-81568849 TCCCATGGCTAGGTGATGGACGG - Intronic
1154210952 18:12377704-12377726 CCCCAGCGGCGGCAGATGGAAGG + Intergenic
1155150769 18:23121288-23121310 CCCGCTGGGAAGCAGATGGATGG - Intergenic
1155494881 18:26433013-26433035 TTCCATGGCCAGCAGAAGGATGG - Intergenic
1155933663 18:31732219-31732241 TCCCAAAGTCAGCAGAAGGAAGG + Intergenic
1157815236 18:50725272-50725294 TTCCAGGGGCAGCATATGGTAGG + Intronic
1159034177 18:63261337-63261359 TCCCAGTGGGAGCAGTTGGAAGG - Intronic
1160578731 18:79871669-79871691 ACCCAGGGGCAGTAGAGGGAGGG + Intronic
1160715740 19:575821-575843 ACCCATGAGCAGCAGGAGGAGGG - Intronic
1160897624 19:1410043-1410065 TTCCCAGGGCAGCAGCTGGACGG - Intronic
1160939679 19:1614433-1614455 TGCCACGGGAAGCAGAGGGACGG + Intronic
1160993946 19:1873293-1873315 TCCCCTGGGGAGCAGCTGGAGGG + Intergenic
1161470035 19:4452611-4452633 TCCCACGGCCACCAGGTGGAAGG - Intronic
1162187678 19:8918542-8918564 TGCCATGGGCACCAGTAGGAGGG - Intronic
1163082339 19:14953078-14953100 GAACATGGGGAGCAGATGGAGGG + Intronic
1163833388 19:19558683-19558705 TCCCATGTGCAGCTGGGGGACGG + Intergenic
1164744521 19:30601378-30601400 TCACGTGGGCAGCAGATTCATGG + Intronic
1165535367 19:36439869-36439891 GACCATGGGCAACAGATGAAAGG + Intergenic
1166827377 19:45617802-45617824 CCCAAAGGGCAGCAGAGGGAGGG - Intronic
1167119042 19:47505859-47505881 TCCCAGGGACAGCAGAGGGTGGG - Intronic
1167367778 19:49064027-49064049 TGGGATGGGAAGCAGATGGAGGG + Intronic
1168465988 19:56601540-56601562 CACCGTGGGCAGCAGAGGGATGG + Exonic
925063962 2:914868-914890 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064000 2:915040-915062 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064020 2:915126-915148 ACCCACAGGCAGAAGATGGAAGG + Intergenic
926128495 2:10286139-10286161 GCCCAGGGGCAGCAGCGGGAGGG + Intergenic
926148949 2:10413995-10414017 TTGCATGGGCAGCAGAGGGGAGG - Intronic
926222811 2:10947493-10947515 TCCCATGGGAAGCGGGTGGCAGG + Intergenic
929538400 2:42800122-42800144 TGCTATGGGTAGCAGATGGGAGG - Intergenic
933347210 2:81103488-81103510 TCCCATGGGCTGAAGGTTGAGGG + Intergenic
933646160 2:84814216-84814238 TCCCATTGGCAGGAGCAGGAAGG + Intronic
934165337 2:89289080-89289102 TCACATGGTCAGCAGAAGTAGGG - Intergenic
934201937 2:89893382-89893404 TCACATGGTCAGCAGAAGTAGGG + Intergenic
935624267 2:105156375-105156397 TCCCATGGCCAGCAGGTGTGGGG + Intergenic
936095189 2:109525876-109525898 TGTCATTGGAAGCAGATGGAGGG + Intergenic
936165523 2:110116394-110116416 TCCCAGGGGCATGAGCTGGAAGG - Exonic
936260827 2:110958657-110958679 TCCCATGGGCAGCAGATGGAAGG + Intronic
936616699 2:114055358-114055380 TACCAAGGGATGCAGATGGAGGG - Intergenic
936751438 2:115647094-115647116 TCCTATGGGCTCCAGATGCATGG + Intronic
936913010 2:117612156-117612178 TCCCAAGGGAAACAAATGGATGG - Intergenic
936922768 2:117706425-117706447 TCACTTGGGCAGCAACTGGAGGG - Intergenic
938112349 2:128577380-128577402 TCCCATAGGCAGCACATGTATGG + Intergenic
939837658 2:147150302-147150324 TGCCATGGACAGCACATTGATGG + Intergenic
942613283 2:177763627-177763649 TCCCATGGACAGCAGCGGGGTGG - Intronic
944184567 2:196932699-196932721 TCCTATGGGTGGAAGATGGAAGG - Intergenic
944581830 2:201138323-201138345 TCCCATGAGCAGCTGCTGGGCGG - Intronic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG + Exonic
947917000 2:233839272-233839294 TCCCAGGGGCTGCACATGGTGGG - Intronic
948434828 2:237945919-237945941 ACGCATGGGGAGCAGAAGGAAGG + Intergenic
948629676 2:239294062-239294084 TCCCATAGGCAGCAGAGGGTGGG - Intronic
948807845 2:240460635-240460657 TCCAGAGGGCAGCAGAGGGAGGG - Intronic
1168900309 20:1358303-1358325 TCCCATGGGAAGAAGGAGGAGGG + Intronic
1168973603 20:1947609-1947631 TCCCATCGTCGGCTGATGGAGGG + Intergenic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1170945953 20:20891150-20891172 TCCCAGGGGCCCCAGAGGGATGG + Intergenic
1173025531 20:39304232-39304254 TCCCCTCGGCTGCAGATGGATGG - Intergenic
1173040749 20:39460180-39460202 TCCCATGGGGAGAAAAGGGAAGG + Intergenic
1173523021 20:43712934-43712956 CCCCATGGTCAGCACCTGGATGG - Intronic
1174202832 20:48819207-48819229 TCGCATGGGCCTCAGATGCATGG - Intronic
1174705704 20:52653839-52653861 TGCCAAGGGCACCAAATGGAAGG - Intergenic
1177822154 21:26043110-26043132 TTCCATGGGCAGAAGAGGGATGG - Intronic
1180081903 21:45490951-45490973 TCACATGGGCAGCAGGGGCACGG - Intronic
1180645265 22:17333479-17333501 TCCCATGGGCTGCATATGTGGGG - Intergenic
1181057582 22:20267478-20267500 TCCCTCGGGCTGCAGATGGCGGG + Intronic
1181990708 22:26834743-26834765 TCCCTTGGTCTGCAGATGTAGGG + Intergenic
1183590584 22:38777233-38777255 GCCCACGTGCAGCAGATGAAAGG + Intronic
1184067049 22:42126989-42127011 TTCCCTGGGCAGGAGATGCAGGG + Exonic
1184069774 22:42140693-42140715 TTCCCTGGGCAGGAGATGCAGGG + Intergenic
1184071517 22:42150301-42150323 TCCCCTGGGCAGGAGATGCAGGG + Intergenic
1184169852 22:42752442-42752464 GCCCATGGGGAGCAGAAGGAGGG + Intergenic
949471716 3:4403496-4403518 TCCCAGGTGCAGCAGAAGAATGG + Intronic
950496950 3:13339613-13339635 TCCCATAAGGAGCAGCTGGAAGG + Intronic
950739763 3:15040895-15040917 TCCCATGGCCAAAAGATGGCTGG + Intronic
951337999 3:21447572-21447594 GCACATGGCCAGCAGAAGGAAGG - Intronic
952979045 3:38720602-38720624 TCCCAGGGGAAGGAGATGGGAGG + Intronic
953472720 3:43180704-43180726 CCCCATGGGCAGCATCTGCAAGG + Intergenic
953748213 3:45591253-45591275 TGCCATGGCCAGCAGGTTGATGG - Intronic
954966056 3:54612094-54612116 TCCCAAGGGGAGCAGAGGAAGGG - Intronic
955263942 3:57423535-57423557 TACTTTGGGCAGCAAATGGAAGG + Intronic
960948319 3:122982150-122982172 TCCCATGAGCAGCAGCTGGTTGG + Intronic
961436415 3:126921504-126921526 TCCCACGGGAAGCAGACTGAAGG - Intronic
961835672 3:129656836-129656858 TACTCTGGGCAGCAGATGAAAGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
964829676 3:160870086-160870108 TCCCATGGTCAGGATCTGGAAGG - Intronic
968921415 4:3524007-3524029 GCCCAGGGGCAGCAGTTGGGTGG + Intronic
969125539 4:4945252-4945274 GCCCATGAGCAGCAGAGGCAGGG + Intergenic
969707519 4:8820046-8820068 TTCCATGGCCAGCAGAGGGCAGG + Intergenic
969723356 4:8905515-8905537 GCCCATGGGCAGCGGGTGGCTGG + Intergenic
970573994 4:17409674-17409696 TCCAATGGTGAGCAGAGGGATGG - Intergenic
970700166 4:18727087-18727109 GCCCAAAGTCAGCAGATGGAAGG + Intergenic
972305046 4:37822876-37822898 TCACATGAGAAGCAGATGGAAGG + Intergenic
975417456 4:74121496-74121518 TCCCATGTGCAGGTGATGGGAGG - Intronic
977590738 4:98823814-98823836 TCTTATTGGCAGCAGATGGTTGG + Intergenic
980253649 4:130349482-130349504 TACCATAGGCAGCAGATGGCAGG - Intergenic
982364576 4:154561216-154561238 TCCCATGGTCAGAAGGAGGATGG - Intergenic
985829329 5:2216549-2216571 TCACATGGGAAGCACCTGGATGG - Intergenic
989392395 5:40914922-40914944 TCCCATGGCCCGCATATGGATGG + Intronic
991514665 5:67421446-67421468 TCCCAAAGTCAGCAGAAGGAAGG + Intergenic
993050396 5:82919783-82919805 TTCCATGACCGGCAGATGGATGG + Intergenic
993879697 5:93347987-93348009 TACAATGTGCAGCAGGTGGACGG - Intergenic
997428040 5:133817687-133817709 TCCCATGGGCAGAACTTGGCAGG + Intergenic
997849395 5:137317321-137317343 CTCCATGGCCAGGAGATGGAAGG - Intronic
998158870 5:139801894-139801916 CCCCATGTACAGCACATGGATGG + Intronic
998790783 5:145764360-145764382 TGCCATGGGCACAGGATGGAAGG - Intronic
999236368 5:150099699-150099721 TGCCAGGGGCTGGAGATGGAGGG + Intronic
999801526 5:155042677-155042699 TCCTATAGGCAGCATATGGTTGG + Intergenic
1000543902 5:162575607-162575629 TCTCATAGGCAGCATATAGATGG - Intergenic
1001015863 5:168140433-168140455 TGCCATTTGGAGCAGATGGAAGG - Intronic
1001429850 5:171650641-171650663 TCCCTAGGGCAGCGGGTGGAGGG - Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1003248222 6:4402027-4402049 TCCTTTGGGTAGCAGAGGGAAGG - Intergenic
1003314337 6:4998067-4998089 TCCCATGAGGAGCAGACAGATGG + Intronic
1003565091 6:7215954-7215976 GCCCAAGGGCGGCAGCTGGATGG + Intronic
1006401647 6:33821271-33821293 TCCACTGGGATGCAGATGGATGG - Intergenic
1009439057 6:63654701-63654723 TCCCTTAGGCAGCAGTTAGAGGG + Intronic
1012156151 6:95821768-95821790 TCCTGAGGGCAGCAGATGGTTGG - Intergenic
1013160881 6:107543545-107543567 GCCCATGGGCAGCATGGGGAGGG + Intronic
1013876799 6:114840977-114840999 TCCTAAAGACAGCAGATGGATGG - Intergenic
1016379552 6:143460952-143460974 TCCCCTGGGAAGCAGATGCTAGG + Intronic
1017267454 6:152465034-152465056 TCCAATGGGCAGCAAAGGGGAGG - Intronic
1018004940 6:159613005-159613027 TCACATGGCCAGGAGATGGGGGG + Intergenic
1018844774 6:167547940-167547962 TTCCATCTGCAGCAGATGGTAGG + Intergenic
1018910293 6:168097714-168097736 CCCCTGGGGCAGCAGATGGGAGG - Intergenic
1019769812 7:2876600-2876622 GCCCACGGGCAGCAGGAGGATGG + Intergenic
1021577777 7:22120144-22120166 TCCTAGGGGTAGCAGAGGGAAGG - Exonic
1022649015 7:32258049-32258071 TTCCAGGGGCAGCAGATGAATGG + Intronic
1024609014 7:51046815-51046837 ACCCAGGGGCAGCAGGAGGAGGG + Intronic
1024794789 7:53007946-53007968 TGCCATGGACAGCAGCTTGATGG + Intergenic
1031104190 7:117519623-117519645 TCCCATGGGAAAAAGCTGGAAGG - Intronic
1033584258 7:142762542-142762564 TCACATGGGCAGGAGAGGGATGG - Intronic
1033586785 7:142780214-142780236 TCCCAAGCCCAGCAGATGGTAGG + Intergenic
1035660179 8:1341798-1341820 TGCCAGGGCCTGCAGATGGAGGG - Intergenic
1036075211 8:5491290-5491312 GCCCATGTATAGCAGATGGAGGG + Intergenic
1036778731 8:11631290-11631312 TACCAGGGGCAGCCTATGGATGG - Intergenic
1037521535 8:19684670-19684692 TCCCAGGGGCAGCACAGGGAGGG - Intronic
1038354665 8:26816425-26816447 TTCCAGGGGCAGCACATGGGTGG - Intronic
1038749497 8:30282517-30282539 TTCCATGGGAAGCAGGAGGAAGG - Intergenic
1039619270 8:38981746-38981768 TACCATGAGCACCAGATGAAAGG + Exonic
1040545163 8:48393317-48393339 TCCCAGGGGCAGCAGAAACAGGG - Intergenic
1041149757 8:54919294-54919316 TCCCAAGACCAGCAGAGGGAAGG - Intergenic
1041430446 8:57776037-57776059 GCCCATGGGCAGGAGCTGGAAGG - Intergenic
1041721158 8:60976766-60976788 CCCCATGGCAAGCAGATGCAGGG - Intergenic
1042764766 8:72308886-72308908 TCACACAGGCAGCAGCTGGATGG + Intergenic
1043110979 8:76181438-76181460 ACCCAAGGCCAGCAAATGGAAGG - Intergenic
1045378980 8:101604109-101604131 TCCCATTGGGATCATATGGATGG - Intronic
1047150236 8:122252674-122252696 TCCCATTGCCAGGTGATGGAGGG + Intergenic
1048547990 8:135404862-135404884 CTCCATGGGCAGCAGGTTGATGG - Intergenic
1049203585 8:141353178-141353200 TCTGATGGGCAGGGGATGGAGGG - Intergenic
1049330072 8:142045741-142045763 GCCCATGAGCAGCAGAAGGCAGG + Intergenic
1049375685 8:142288018-142288040 GCTCATGGGAAGCAGATTGATGG - Intronic
1049541876 8:143212362-143212384 TCCCAAGGGCAGCAGAGGGGTGG - Intergenic
1051618861 9:19032198-19032220 TGCCCTGGGAAGCAGATAGAAGG + Intronic
1051851894 9:21519007-21519029 TCACATGGCCAGAAGGTGGAAGG - Intergenic
1053542403 9:38987748-38987770 TCCCACGGGAAGGACATGGATGG + Intergenic
1053806856 9:41811266-41811288 TCCCATGGGAAGGACATGGATGG + Intergenic
1054623738 9:67376161-67376183 TCCCACGGGAAGGACATGGATGG - Intergenic
1054760097 9:68997059-68997081 TCTGATGGGCAGCTGTTGGACGG + Intronic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1056507079 9:87267799-87267821 TCCCACGGGCACCAGATGCTGGG - Intergenic
1056899455 9:90584347-90584369 TCCCATGAGCAACTGATGCAAGG + Intergenic
1060996325 9:127876574-127876596 TCCCATGGGCAGCTGCTGAGGGG - Intronic
1061798175 9:133100563-133100585 TCACATGGGGAACAGAAGGACGG - Intronic
1061933591 9:133845699-133845721 TGCCATGGGCAGGGGATGGAAGG - Intronic
1062021046 9:134319581-134319603 TCCCATGGGCAGCAGACCCCTGG - Intronic
1062511799 9:136910294-136910316 TCTCATAAGCAGCACATGGAGGG - Intronic
1062549757 9:137080566-137080588 TCCCATGGGCAGCAAGTCTAGGG - Intronic
1185652901 X:1661606-1661628 GCCAATGGGGAGCAGATGCAGGG - Intergenic
1185705708 X:2264848-2264870 ACCCATGCCCAGCAGATGCAGGG + Intronic
1186793693 X:13023810-13023832 TGCAATGGGCAGCTAATGGAAGG + Intergenic
1188846060 X:35073961-35073983 TCTCATAGGCAACAGATGAAAGG + Intergenic
1189200715 X:39193607-39193629 TCCCATGAACAGTGGATGGATGG + Intergenic
1189526065 X:41823279-41823301 TTCGATAGGCAGCAGGTGGAGGG - Intronic
1190333069 X:49247682-49247704 TCCCTTCGGGAGCAGCTGGAAGG + Exonic
1190456743 X:50634770-50634792 TACCAGGGGCAGCAAAGGGATGG - Exonic
1190837707 X:54116556-54116578 ACACATGAGCAGCAGATGGGTGG + Exonic
1191215566 X:57929326-57929348 TCCCATGGGCATCAGAGGCTTGG - Intergenic
1194413090 X:93579085-93579107 TCCCATGGGCAGCCATGGGAGGG - Intergenic
1195975438 X:110521320-110521342 TCCCATGGGCAGCACACGCTGGG - Intergenic
1198275484 X:135094865-135094887 TCCCATGGCCAGGAGCTGGCAGG - Intergenic
1198311032 X:135425832-135425854 TCCCATGGCCAGGAGTTGGCAGG + Intergenic
1198730096 X:139719439-139719461 GTCCAAGGGCAGCAGATGAAGGG - Intergenic
1200466365 Y:3525493-3525515 TCACATGGACAGTAGATGGTTGG + Intergenic