ID: 936261415

View in Genome Browser
Species Human (GRCh38)
Location 2:110962551-110962573
Sequence AGCATCAGTCCTGCTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936261415_936261417 -9 Left 936261415 2:110962551-110962573 CCCACAGGAGCAGGACTGATGCT 0: 1
1: 0
2: 0
3: 13
4: 209
Right 936261417 2:110962565-110962587 ACTGATGCTAACAAGTTTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 123
936261415_936261421 15 Left 936261415 2:110962551-110962573 CCCACAGGAGCAGGACTGATGCT 0: 1
1: 0
2: 0
3: 13
4: 209
Right 936261421 2:110962589-110962611 ATCTGAGGGCAGCAGGCACCTGG 0: 1
1: 0
2: 0
3: 37
4: 305
936261415_936261419 1 Left 936261415 2:110962551-110962573 CCCACAGGAGCAGGACTGATGCT 0: 1
1: 0
2: 0
3: 13
4: 209
Right 936261419 2:110962575-110962597 ACAAGTTTTCAGGCATCTGAGGG 0: 1
1: 0
2: 1
3: 26
4: 230
936261415_936261420 8 Left 936261415 2:110962551-110962573 CCCACAGGAGCAGGACTGATGCT 0: 1
1: 0
2: 0
3: 13
4: 209
Right 936261420 2:110962582-110962604 TTCAGGCATCTGAGGGCAGCAGG 0: 1
1: 0
2: 3
3: 32
4: 287
936261415_936261418 0 Left 936261415 2:110962551-110962573 CCCACAGGAGCAGGACTGATGCT 0: 1
1: 0
2: 0
3: 13
4: 209
Right 936261418 2:110962574-110962596 AACAAGTTTTCAGGCATCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936261415 Original CRISPR AGCATCAGTCCTGCTCCTGT GGG (reversed) Intronic
900170913 1:1268323-1268345 AGCCTCAGACCAGCTCCTGAGGG + Intronic
900334166 1:2153220-2153242 AGCATCTTTCATGCACCTGTTGG + Intronic
900526152 1:3129805-3129827 AGAATCAGACAGGCTCCTGTTGG - Intronic
901331436 1:8412089-8412111 AGCATCTGTCCAGCACCTTTGGG - Intronic
901822928 1:11841717-11841739 AGCATCAGTCCTGGCTCTGCTGG + Exonic
902050970 1:13563381-13563403 AACATCTGTGATGCTCCTGTGGG - Intergenic
902230583 1:15024883-15024905 AGCATCAGTCCTGGTGATCTCGG - Intronic
904261880 1:29292135-29292157 AGCATCTGTGGTGCTCCTGCTGG + Intronic
905429340 1:37910152-37910174 AGCATCTGTGATGGTCCTGTAGG - Intronic
906281941 1:44560390-44560412 ATCATCAGTTCGGCTCCTGGAGG + Intronic
909035519 1:70590801-70590823 AGCATCTGTGATGGTCCTGTAGG - Intergenic
909788217 1:79641934-79641956 AGCATCTGTGATGGTCCTGTAGG + Intergenic
910170513 1:84372109-84372131 AGCATCAGTCCTTCACCTCAGGG + Intronic
911071119 1:93832557-93832579 AGCATCTGTGATGGTCCTGTAGG - Intronic
915087700 1:153399262-153399284 AGGCTCAGTCCTGCTCCTGAAGG - Intergenic
916723832 1:167505536-167505558 AGCATGAGTGCAGCTCATGTGGG + Intronic
918608130 1:186454584-186454606 ATCATCAGTCCTGCATCTCTAGG + Intronic
919012886 1:191988150-191988172 AGCACCAGTCATGATCCTGCTGG + Intergenic
919038542 1:192349736-192349758 AGTATCTTTCCTCCTCCTGTAGG - Intronic
922718414 1:227888397-227888419 AGGATGAATCCTGCTTCTGTTGG + Intergenic
1063405868 10:5794308-5794330 AGAATGAGTACTTCTCCTGTTGG + Intronic
1063867972 10:10387924-10387946 ACCTTCAGCTCTGCTCCTGTTGG + Intergenic
1066165824 10:32787868-32787890 AGCTTCAGGCCTGCCCCTGAAGG + Intronic
1067566966 10:47346397-47346419 AGAAGCAGTGCTTCTCCTGTGGG - Intergenic
1071168768 10:82838007-82838029 AGCATCACTCCTGCTCCTCCTGG - Intronic
1072011228 10:91304698-91304720 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1072753585 10:98001939-98001961 AGCATCACTGCTGCTCCAGGGGG - Intronic
1072884574 10:99262090-99262112 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1073900748 10:108217422-108217444 AACATCCTTCCTGCACCTGTAGG - Intergenic
1074156808 10:110807023-110807045 AGCATCAGTTCTGCTATTTTAGG - Intronic
1074919203 10:117990099-117990121 ATCATCACTCCTGCTGCTTTAGG - Intergenic
1076058508 10:127394927-127394949 GGCATCACTCCTGCACCTGTGGG - Intronic
1076755213 10:132567014-132567036 GGTATTAGTCCGGCTCCTGTAGG + Intronic
1077388842 11:2289984-2290006 AGCGTCAGTACTGCTCATGGGGG + Intergenic
1077679019 11:4222460-4222482 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1077688455 11:4319101-4319123 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1079031273 11:16988085-16988107 CACATCAGTCCTTCCCCTGTAGG - Intronic
1079727026 11:23890393-23890415 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1080281621 11:30563804-30563826 AGCATCAATCCTGCCCTTATAGG + Intronic
1083038768 11:59666669-59666691 AGCACCTATCCTGCTCCTCTGGG - Intronic
1083534459 11:63455410-63455432 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1085777260 11:79378247-79378269 AAGATCTGTCCTGCACCTGTAGG + Intronic
1086533906 11:87819943-87819965 AGCAGCAGGACTGCTCCTATTGG + Intergenic
1087099147 11:94348220-94348242 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1089866996 11:121641135-121641157 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1094825801 12:34268138-34268160 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1096025247 12:48355150-48355172 AGCATTCTTCCTGCTGCTGTTGG + Intergenic
1096558067 12:52415982-52416004 AGCCTCAGCCCTGCTGTTGTTGG + Intergenic
1096606749 12:52772115-52772137 AGCTTCAGACTTGCTCCTCTGGG + Exonic
1096612065 12:52808707-52808729 AGCCTCAGCCTTGCTCCTCTGGG + Exonic
1098653776 12:73005178-73005200 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1098796469 12:74894444-74894466 AGCATCAGTTCTAATCCTCTAGG + Intergenic
1102246969 12:111362127-111362149 AGCCACCGTCCTGCTCCTGGAGG + Exonic
1102988604 12:117298602-117298624 AGCATGGGTCCTGATCCAGTAGG + Intronic
1110317911 13:74132865-74132887 AGAATCAGTCCTGCTTTTGTTGG - Intronic
1110845394 13:80186173-80186195 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1112023989 13:95395769-95395791 GGCATCGGTGCTGCTCCTGGAGG + Intergenic
1112436748 13:99396009-99396031 TGCCTCTGTCCTGATCCTGTGGG + Intergenic
1112889268 13:104211272-104211294 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1115951590 14:38727846-38727868 AGCCTCAGTCCTGCTGCGCTTGG - Intergenic
1118326156 14:64782601-64782623 TGGATCAGCCCTGCTCCTGATGG + Intronic
1120618304 14:86733848-86733870 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1124015042 15:25866617-25866639 AGCACGACTCCTGCTCCTGAGGG - Intergenic
1124338304 15:28873594-28873616 ACCATCTGTCCTGCTTCTCTAGG - Intergenic
1125922530 15:43533933-43533955 TGCCTCAGTCCTGTTCCTCTGGG - Exonic
1127363314 15:58264344-58264366 GGCCTCAGTCCAGCTCCTGGTGG - Intronic
1131684232 15:94753275-94753297 AGCATCTGTGATGATCCTGTAGG - Intergenic
1132067603 15:98744914-98744936 AGCACTAGTCCTCCTCCTGAGGG - Intronic
1137589418 16:49684681-49684703 AGCAGCAGTCCAGTTCATGTAGG + Intronic
1138016913 16:53436531-53436553 AGCAGCAAACCTGCTCTTGTGGG + Intronic
1138524066 16:57591663-57591685 GGCCTCAGACCTGCTCTTGTTGG - Intronic
1145202269 17:20956976-20956998 AGCCTCAGCCAGGCTCCTGTAGG - Intergenic
1147314826 17:39614797-39614819 AAGATCTGTCCTGCTCCTGTTGG + Intergenic
1147497951 17:40936198-40936220 AGCATCTTACCTGCTCCTGCAGG + Exonic
1149186904 17:54008834-54008856 AGCATGGGTCCTGCTCTGGTGGG - Intergenic
1149237951 17:54615346-54615368 AGAATGAGTTCTGCTGCTGTTGG - Intergenic
1150042890 17:61882266-61882288 ATCATCAGTACTGCTTCTCTTGG - Intronic
1151238140 17:72736519-72736541 TCCATCAGTCTTGGTCCTGTGGG + Intronic
1152747102 17:82046104-82046126 AGCATGTGTTCTGCTGCTGTCGG + Intergenic
1156237408 18:35218271-35218293 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1157993664 18:52528616-52528638 AGGATCAGCCCTGCTCTTGAGGG - Intronic
1160534472 18:79584841-79584863 AGCATGGGTCCTGCTCACGTGGG - Intergenic
1161621070 19:5297468-5297490 ACCAGCACTCCTGCCCCTGTTGG + Intronic
1163728010 19:18933281-18933303 TGCATCAGACTTGCTCCTGGGGG - Intronic
1167902202 19:52630274-52630296 AGCATCTGTGATGGTCCTGTAGG - Intronic
925786190 2:7433146-7433168 AGCATCTGTCTGGCTCCTGAAGG + Intergenic
926892287 2:17649076-17649098 TGCCTCAGTCCTGTTCCTGGGGG + Intronic
927480304 2:23448520-23448542 AGCCTCCATCCTGCTCCTCTAGG - Intronic
928945764 2:36770585-36770607 AGCCTCCTTCCTGCACCTGTAGG - Intronic
930463203 2:51710351-51710373 AGCCTCTGTCCAGCTCCTGGAGG + Intergenic
931608880 2:64078382-64078404 AGCATCTGTGATGGTCCTGTAGG + Intergenic
931721065 2:65068190-65068212 AGCATTGGTCTTCCTCCTGTTGG + Intronic
936261415 2:110962551-110962573 AGCATCAGTCCTGCTCCTGTGGG - Intronic
937363031 2:121242295-121242317 ACCAGCAGCCCTGCTCCTGGTGG + Intronic
938492169 2:131767008-131767030 AGCAGCAGCCCTGCTGCTGAAGG + Exonic
938495398 2:131795335-131795357 AGCAGCAGCCCTGCTGCTGAAGG - Exonic
939208502 2:139140338-139140360 AGCATCAGTCATTCTCCTCCTGG + Intergenic
940255930 2:151729289-151729311 ACCATCCCTCCTGCTGCTGTTGG + Intronic
942195467 2:173514441-173514463 AGGATCCTTCCTGCACCTGTTGG - Intergenic
943780190 2:191815128-191815150 GGCATCAGTCCTGCTCTGGAGGG - Intergenic
943945363 2:194054684-194054706 AGAATCAGTCTTGTTGCTGTAGG + Intergenic
943951239 2:194134090-194134112 AGCATCTGTGATGGTCCTGTAGG + Intergenic
945301435 2:208219444-208219466 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1169522032 20:6384569-6384591 GGCAACAAACCTGCTCCTGTGGG + Intergenic
1173637832 20:44576575-44576597 AGCCTCAAACCTTCTCCTGTTGG + Intronic
1173807944 20:45938499-45938521 AGAATCAGTAGTGCTCCTGTTGG + Intronic
1175289042 20:57860995-57861017 AGCATCAGTCCTGTGCCCATAGG - Intergenic
1175317881 20:58064414-58064436 AGCCCCAGTCCTGCTACTGTGGG + Intergenic
1175653917 20:60752376-60752398 AGGCTCAGTCTTGCCCCTGTGGG - Intergenic
1176709458 21:10136816-10136838 AGCAGCAGCCCTGCTGCTGAAGG + Intergenic
1177031127 21:15982999-15983021 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1178342824 21:31800685-31800707 TGCCTCAGTCCTGCTCATGGGGG + Intergenic
1181267794 22:21641353-21641375 AGCTTCACTCCAGATCCTGTGGG - Intergenic
1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG + Intronic
1182998651 22:34836816-34836838 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1183876737 22:40789220-40789242 AGCATCTGTCATACTCCTGCCGG - Intronic
1183989068 22:41585992-41586014 AGATCCAGTCCTGCTTCTGTGGG - Intronic
1184745538 22:46453583-46453605 CGCCTCTGTCCTGCTCCTGGGGG - Intronic
950450127 3:13060703-13060725 AGCATCAGCCCTGCCCCCGGCGG + Intronic
951316270 3:21192403-21192425 AGCATCTGTGATGGTCCTGTAGG + Intergenic
953451155 3:43007516-43007538 AGCACCAGTCCTTTACCTGTTGG + Intronic
954713460 3:52516036-52516058 GGCAGCAGTCCGGCACCTGTCGG - Exonic
954753542 3:52826966-52826988 GGCATCAGGCCTGCTCCTCCAGG + Intronic
955123184 3:56082599-56082621 AGGATCAGTCCTGATCCCTTTGG + Intronic
955472078 3:59296148-59296170 CCCATCAGTCCTACTTCTGTGGG + Intergenic
957059850 3:75473235-75473257 AGCATCTGTGATGGTCCTGTAGG + Intergenic
957985737 3:87571842-87571864 AGCATCTGTGATGGTCCTGTAGG - Intergenic
958182938 3:90083567-90083589 AGCATCCGTGATGGTCCTGTAGG - Intergenic
959021811 3:101195605-101195627 AGTACCAGTCCTGGTCCTGCGGG - Intergenic
960987852 3:123292244-123292266 AGAGTCAGTCCTGGTCCTGTTGG - Intronic
961293554 3:125866202-125866224 AGCATCTGTGATGGTCCTGTAGG - Intergenic
962872134 3:139506628-139506650 AGCATCTGCCCTGCTCATTTTGG - Intergenic
963468659 3:145712900-145712922 AGCATCTGTAATGGTCCTGTAGG - Intergenic
965105186 3:164345327-164345349 AGCATCTGTGATGGTCCTGTAGG + Intergenic
967828951 3:193902469-193902491 AGCCTCCCTCCTGCTCCTGCTGG + Intergenic
970195489 4:13547237-13547259 CGCAGCAGGCCTGCGCCTGTCGG + Intergenic
974005404 4:56551462-56551484 AGCTGCAGGCCTCCTCCTGTAGG - Intronic
976558615 4:86477089-86477111 AGCATCTGTGATGGTCCTGTAGG - Intronic
977926431 4:102705494-102705516 TGCAGCAGCCCTGCTCCTGAGGG - Intronic
979171365 4:117603521-117603543 AGCATCTGTGATGGTCCTGTAGG + Intergenic
980162950 4:129188053-129188075 AGAATCAGACCTGCTGCTGAGGG - Intergenic
980702585 4:136452678-136452700 AGCATCAGGCAGGCCCCTGTGGG + Intergenic
985003062 4:185504699-185504721 TGCATCAGTCCTGCCCCTCTCGG - Intronic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
986675385 5:10179612-10179634 ACCACCAGACCTGCTCCTGAAGG + Intergenic
986784890 5:11105120-11105142 AGCATCAGTGATGCCCCAGTTGG - Intronic
990912604 5:60867737-60867759 AGCAGCTCTCCTGCTCCTGGTGG + Intergenic
993020437 5:82584831-82584853 AGCATCACTGCAGCTCCAGTTGG - Intergenic
994778900 5:104067409-104067431 AGCATCTGTGATGGTCCTGTAGG + Intergenic
996112893 5:119585742-119585764 AGTTTCAATCCTGCCCCTGTGGG - Intronic
997928664 5:138054234-138054256 AGCATCAGTCCTGCTTTTCATGG - Intergenic
998693656 5:144614553-144614575 AGCATCTGTGGTGGTCCTGTAGG + Intergenic
1000885274 5:166742303-166742325 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1001014711 5:168129784-168129806 AGCATCAGTTCTCCTCCTTGGGG + Intronic
1001048843 5:168397868-168397890 AGCATCTGTTCTGGTCTTGTGGG - Intronic
1003036392 6:2644087-2644109 AGCTTCAGTCCTGCAGCTGCTGG - Intergenic
1003800172 6:9655368-9655390 TGAGTGAGTCCTGCTCCTGTGGG - Intronic
1004614586 6:17278641-17278663 GGCATCATTGCTGCCCCTGTGGG - Intergenic
1006987763 6:38188042-38188064 TGCATCTGTCTTGCTCCAGTCGG - Intronic
1007593254 6:43036127-43036149 AGCCTCTGCCCTGCTGCTGTTGG - Intergenic
1009639012 6:66306046-66306068 AGCATATGTTCTGCTGCTGTTGG + Intergenic
1012629508 6:101446090-101446112 AGCACCTGGCCTGTTCCTGTTGG + Intronic
1014578586 6:123106159-123106181 AGCATCATCCCTCCTCCTGATGG + Intergenic
1015165263 6:130194842-130194864 AGCATCTGTGATGGTCCTGTAGG - Intronic
1016962137 6:149684112-149684134 GGCATTAGTTCTGTTCCTGTTGG - Exonic
1017959758 6:159211160-159211182 AGCATCAGGCCTGCTCTTTCAGG + Intronic
1019428637 7:988582-988604 TGCACCAGGCCTGCTCCTGGAGG - Intronic
1019738059 7:2660142-2660164 TCCATCTGTCCGGCTCCTGTTGG + Intronic
1020323899 7:6959875-6959897 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1020541099 7:9461769-9461791 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1020625495 7:10573686-10573708 AGCCTCAATCCTGAGCCTGTGGG + Intergenic
1020794264 7:12662061-12662083 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1022991247 7:35709783-35709805 AGAAACAGTTCTGCTCATGTAGG + Intergenic
1023863774 7:44229359-44229381 AGCCTGGGTCCTGCTGCTGTGGG - Intronic
1024034727 7:45497638-45497660 GGCATCAGCCAAGCTCCTGTGGG + Intergenic
1025142129 7:56475187-56475209 AGCCTCAGGCCTGCTTCTGAGGG + Intergenic
1025708276 7:63886615-63886637 AGCCTCAGGCCTGCTTCTGAGGG + Intergenic
1027337402 7:77166900-77166922 AACCTCAGTTTTGCTCCTGTGGG + Intronic
1027734979 7:81920689-81920711 AGCATCCTTCCTGTTCTTGTTGG + Intergenic
1028452830 7:91005073-91005095 AGCCTCTGTCCTGCTGCTATGGG - Intronic
1028690223 7:93642359-93642381 AGCATCTGTGATGGTCCTGTAGG - Intronic
1029778398 7:102704221-102704243 AACCTCAGTTTTGCTCCTGTGGG - Intergenic
1030153193 7:106426565-106426587 AATATCAGTCCTGGTCCTGGCGG + Intergenic
1031777390 7:125920108-125920130 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1032383423 7:131505918-131505940 GGCATCATTCCTGCTCCTCGTGG - Exonic
1033084764 7:138331523-138331545 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1033625635 7:143107317-143107339 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1035096688 7:156361621-156361643 AGCATCACGCCTGCTCGTGGTGG - Intergenic
1036347012 8:7973018-7973040 AGCAGGAGACCTGCTGCTGTGGG - Intergenic
1037844149 8:22267871-22267893 AGCATCCTCCTTGCTCCTGTAGG + Intergenic
1040567310 8:48579328-48579350 ACCATCAGCCCTGCCCATGTGGG - Intergenic
1043008778 8:74855844-74855866 AGCATCAGTCAGGCCTCTGTGGG - Intergenic
1048097653 8:131312703-131312725 AGCATCTGTGATGGTCCTGTAGG - Intergenic
1050012795 9:1201819-1201841 TGGAGCAGCCCTGCTCCTGTGGG + Intergenic
1051880570 9:21835646-21835668 AGCACCAGTCCTCCTTCTGAAGG - Intronic
1053646429 9:40122352-40122374 AGCAGCAGCCCTGCTGCTGAAGG + Intergenic
1053759284 9:41341199-41341221 AGCAGCAGCCCTGCTGCTGAAGG - Intergenic
1054327441 9:63720254-63720276 AGCAGCAGCCCTGCTGCTGAAGG + Intergenic
1054538140 9:66253621-66253643 AGCAGCAGCCCTGCTGCTGAAGG - Intergenic
1055347667 9:75354992-75355014 AGCATCTGTGGTGGTCCTGTAGG + Intergenic
1055702028 9:78955237-78955259 AGCAACAGTCCTACTGCAGTCGG + Intergenic
1057016769 9:91658915-91658937 TGCAGCAGCCCTGCTCTTGTCGG - Intronic
1057092855 9:92275725-92275747 AGCAGCACTGCTGCTCCTGGTGG - Intronic
1059465662 9:114467306-114467328 AGACACAGTCCTGCTCCTGAGGG + Intronic
1059546116 9:115177831-115177853 AGCATCTGTGATGGTCCTGTAGG + Intronic
1060014972 9:120079136-120079158 AGCCTCAGTCTTGCTACTGTTGG - Intergenic
1061383642 9:130275790-130275812 ACCATCAGTCCTTCTTCTGAGGG + Intergenic
1061884865 9:133586359-133586381 AGCACCAGTCCCCCTGCTGTGGG - Intergenic
1062532039 9:137006293-137006315 AGCCTCCGTCCTGCAACTGTAGG - Intergenic
1202794217 9_KI270719v1_random:105783-105805 AGCAGCAGCCCTGCTGCTGAAGG + Intergenic
1185654949 X:1677213-1677235 AGTGTCAGTCTTGCCCCTGTGGG + Intergenic
1185663049 X:1742336-1742358 GGCATATGTCCTGGTCCTGTAGG + Intergenic
1187093507 X:16122278-16122300 AGCATCAGTCTCCCTCCTGCTGG + Intergenic
1190020540 X:46869990-46870012 AGCATCAGTTCTAGTGCTGTTGG - Intronic
1190296312 X:49029860-49029882 AGCCTCACCCCTGCCCCTGTGGG - Exonic
1192314474 X:70041337-70041359 GGCCCCAGTCCTACTCCTGTAGG + Exonic
1193348764 X:80433026-80433048 ATCATCAGTTCAGCTCCTGATGG - Intronic
1194774130 X:97942510-97942532 AGCATCACACCTACTCATGTAGG - Intergenic
1196725367 X:118890423-118890445 AGCACAAGTCCTGGTCCAGTTGG - Intergenic
1196992640 X:121346202-121346224 AGCATCTGTGATGGTCCTGTAGG + Intergenic
1199314231 X:146358368-146358390 AGCATAAGCCCTTCTCCTGTAGG - Intergenic
1199767185 X:150949807-150949829 AGCATCACTCATGCTGCTGCAGG - Intergenic