ID: 936262347

View in Genome Browser
Species Human (GRCh38)
Location 2:110972475-110972497
Sequence CGGTCCCCAGGGTCACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936262338_936262347 30 Left 936262338 2:110972422-110972444 CCTCAAGTGATGATCCAGCCGGA 0: 1
1: 0
2: 0
3: 9
4: 354
Right 936262347 2:110972475-110972497 CGGTCCCCAGGGTCACCCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 236
936262339_936262347 16 Left 936262339 2:110972436-110972458 CCAGCCGGAAACACTTCTTGTAT 0: 1
1: 0
2: 2
3: 6
4: 92
Right 936262347 2:110972475-110972497 CGGTCCCCAGGGTCACCCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 236
936262340_936262347 12 Left 936262340 2:110972440-110972462 CCGGAAACACTTCTTGTATAAGT 0: 1
1: 0
2: 0
3: 11
4: 208
Right 936262347 2:110972475-110972497 CGGTCCCCAGGGTCACCCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936262347 Original CRISPR CGGTCCCCAGGGTCACCCCC AGG Intronic
900114684 1:1023466-1023488 GGGTCCCCTGGGTCCCCCACTGG + Intronic
900389757 1:2428824-2428846 CTGGCTCCAGGCTCACCCCCAGG - Intronic
900917303 1:5647736-5647758 CCGTCCCCAAGGCCACCCTCGGG - Intergenic
901199332 1:7457829-7457851 GGGTCTCCAGGGTCCCCACCTGG + Intronic
901218142 1:7566209-7566231 TGGGCCCCTGGGTGACCCCCAGG + Intronic
901887123 1:12230694-12230716 TGCCCCCCAGGGTCACGCCCTGG + Intronic
903261255 1:22132862-22132884 CAGACCCCAGGGTCTCGCCCGGG + Intronic
903330584 1:22595126-22595148 CTGGCCCCAGGGTCACAGCCAGG + Intronic
906007300 1:42486777-42486799 GAGTTCCCAAGGTCACCCCCAGG - Intronic
907249040 1:53125772-53125794 CGTTCCACAGGGCCACCCCGTGG + Intronic
907257947 1:53194359-53194381 CAGACCCCAGGGCCATCCCCAGG + Intergenic
907526589 1:55057363-55057385 AAGTCCCCAGGGTCACCGGCTGG - Exonic
912363589 1:109114387-109114409 GGGTCCCCAAGGTCTCCGCCTGG - Intronic
912455389 1:109793280-109793302 GGGTCACCAGGGTCAGCCCATGG + Intergenic
912775254 1:112502629-112502651 CGGTCCCCAGCCTCACCCTCCGG + Intronic
914001429 1:143698195-143698217 CCGTCCCCAGGGTAGCCACCAGG + Intergenic
919731600 1:200916521-200916543 CGGCCCCCAGGGCCGCACCCAGG - Intergenic
920331351 1:205211002-205211024 CGGTCCCCGGGGTCCCGCTCCGG + Intronic
921591706 1:217011801-217011823 CTGTCCCCAGGCTCACCCTCTGG + Intronic
922209111 1:223474087-223474109 TCCTCCCCAGGGTCACTCCCTGG + Intergenic
922561286 1:226571596-226571618 TGGACCCCAGGGTTACCCCTTGG + Intronic
922887525 1:229031500-229031522 CCGTCCCCAGGGTCCAGCCCAGG - Intergenic
923779779 1:237011920-237011942 AGGGCTCCAGAGTCACCCCCAGG + Intergenic
1063665459 10:8058110-8058132 CTGTCCCCAGCCTGACCCCCAGG + Intronic
1064012018 10:11742812-11742834 CGGTTCCCCGGGTCCTCCCCGGG - Intronic
1064097812 10:12436827-12436849 TGGTCCCCAAGACCACCCCCAGG + Intronic
1065590753 10:27259077-27259099 GGGTCCCCAGGCCCACCCCATGG + Intergenic
1069873079 10:71544965-71544987 CTGTCCCCAGGGTTACCCCAGGG - Intronic
1073204205 10:101760096-101760118 GGCTGCCCAGGGTCAGCCCCTGG - Intergenic
1076807336 10:132865530-132865552 CGGTCCCCAGCGAAAGCCCCGGG - Intronic
1076921848 10:133458409-133458431 CGGTGCCCCAGGTCACCTCCAGG - Intergenic
1077119172 11:898922-898944 CCGTGCTCAGGGACACCCCCAGG + Intronic
1077358208 11:2128288-2128310 TGGCCCCCAGGGTCTGCCCCTGG - Intergenic
1078084581 11:8225958-8225980 AGGTCCCCAGGGACTCCCACAGG + Intronic
1078112462 11:8408654-8408676 AGGTCCCCACAATCACCCCCAGG + Intronic
1080230909 11:30017077-30017099 CGGTCGCCAGGGGCGCCTCCCGG + Intergenic
1082879170 11:58021569-58021591 TGGTCCCATGGGTCACCCCTGGG + Intergenic
1082965285 11:58960608-58960630 CGGTGTCCAGGGTCACCCTGTGG + Intronic
1083234232 11:61341644-61341666 CAGTCCCCAGGAGCTCCCCCAGG - Intronic
1083902253 11:65649340-65649362 TGGGCAGCAGGGTCACCCCCTGG - Exonic
1084316707 11:68349826-68349848 CGGCCCCCAGAGTCACTCCCAGG - Intronic
1085279291 11:75319782-75319804 GGGTCCCCAGGGGGACCCCTTGG + Intronic
1088604216 11:111512806-111512828 CGGCCCCCGAGGACACCCCCGGG - Intergenic
1089103734 11:115985018-115985040 GGGTCCCAAGGGTCACCCAAGGG - Intergenic
1089443412 11:118533661-118533683 CCGTACCCATGGCCACCCCCTGG - Intronic
1091319459 11:134639697-134639719 CTGTCCCCATGGTCTCCCACGGG + Intergenic
1091656690 12:2351442-2351464 CGGTCCCCAAGGCCACTTCCTGG + Intronic
1092205534 12:6612635-6612657 TGGTCCCCAGGCTCAAACCCAGG + Intergenic
1092893204 12:12988869-12988891 AGATCCCCAGAGTCAGCCCCTGG - Intronic
1094057613 12:26282901-26282923 GAGTCTCCAGGGTCACCCCGTGG - Intronic
1094104912 12:26801000-26801022 CCTTCACCAGGGCCACCCCCAGG - Intronic
1094829980 12:34295681-34295703 CGATCCCCCGGGCCACCCACAGG - Intergenic
1096256724 12:50066551-50066573 CTTTCCCCAGGGTCACACCAGGG + Intronic
1096311630 12:50526228-50526250 CTGTCCCCAGGGTCTCTGCCAGG + Intronic
1096983639 12:55743172-55743194 CGGCCCCCCGGGTCCCCCCTCGG + Intergenic
1097527475 12:60755555-60755577 AATTCCCCAGGGTCAACCCCTGG + Intergenic
1101846424 12:108366752-108366774 AGGTCCCCAGAGTCATCCCTGGG + Intergenic
1101871404 12:108568627-108568649 CTGTCTCCAGGATCACCCGCAGG + Intronic
1102258766 12:111430860-111430882 GGGTCCCCAGGGTCCCTCCCCGG + Intronic
1103714329 12:122935221-122935243 GGGCCCACAGGGTCACCCTCAGG - Intronic
1104805274 12:131585969-131585991 CAGTCCCCAGAGTCCACCCCAGG + Intergenic
1104807849 12:131600838-131600860 AGGACCCCACGGGCACCCCCAGG + Intergenic
1104936096 12:132365139-132365161 CGGTGTCCAGGGTCACTCACAGG + Intergenic
1104936103 12:132365174-132365196 CGGTGTCCAGGGTCACTCACAGG + Intergenic
1104936110 12:132365209-132365231 CGGTGTCCAGGGTCACTCACAGG + Intergenic
1104967135 12:132513420-132513442 AGATCCCCACTGTCACCCCCCGG - Intronic
1105408332 13:20150107-20150129 CGGTCACCAGGGTTAGCCTCTGG - Intronic
1108894430 13:55306587-55306609 AGGTCCCCAAGGTCATCCTCTGG - Intergenic
1112286882 13:98112294-98112316 GGGTCCCCAAGACCACCCCCAGG - Intergenic
1113402206 13:110004634-110004656 CTGTCTTCAGGGCCACCCCCAGG - Intergenic
1113494557 13:110716093-110716115 GGAGCCCCAGGGTCACCCCACGG - Intronic
1113820291 13:113208760-113208782 CGGTCCCCAGGTTCTCCCTCCGG - Intronic
1117251844 14:53946830-53946852 CGGTCCCCCTGGTCCCCCGCAGG + Intergenic
1118638671 14:67772013-67772035 CGGTCTCCACTGTCACCCTCAGG - Intronic
1118640594 14:67788684-67788706 GGGTCCCCAAGTCCACCCCCAGG - Intronic
1119725769 14:76920945-76920967 CGGTCTTCAGGATGACCCCCAGG + Intergenic
1121574142 14:94969544-94969566 CTGCTCCAAGGGTCACCCCCAGG - Intergenic
1122125164 14:99574917-99574939 CCATCCCATGGGTCACCCCCAGG + Intronic
1122930653 14:104931765-104931787 CTGTCCCCAGGGCCGCACCCGGG + Exonic
1125735650 15:41923574-41923596 AGATCCCCAGGCTCAGCCCCAGG - Intronic
1126592516 15:50354641-50354663 CGGTCCCGAGCGGCAGCCCCGGG - Intronic
1127606361 15:60591985-60592007 CGGTCCCCAGGGCCCGCACCCGG - Intronic
1128795923 15:70466492-70466514 CGGTTGCCATGGTCACCACCTGG - Intergenic
1132113673 15:99120416-99120438 CAGTCCTCAGGGCCTCCCCCTGG - Intronic
1132586064 16:706146-706168 CGGACCCCTGGGCCACCCGCCGG - Intronic
1132613121 16:827552-827574 CGCTCCCCGGAGTCACCCCAGGG + Intergenic
1133059012 16:3162157-3162179 CTGTCGCCAGGGGCACCTCCCGG - Intergenic
1134014782 16:10880265-10880287 AGGTTCCCGGGCTCACCCCCAGG + Intronic
1134337821 16:13317592-13317614 AGGTTCCCAGGGTCACCCAGAGG - Intergenic
1136373002 16:29847860-29847882 GGGGCCCGAGGGTCAGCCCCTGG + Exonic
1137954741 16:52817732-52817754 CTGTCCTCAGTGTCACCCCCTGG - Intergenic
1138650302 16:58456827-58456849 GAGTCCCCAGGATCACCCTCAGG - Intergenic
1139430957 16:66910837-66910859 CCTTCCCCAGGGGCAGCCCCTGG + Intronic
1139922213 16:70467468-70467490 CTGTCCCCAGGGGCACTACCTGG - Exonic
1141303223 16:82837398-82837420 AGGTCCCCAAGACCACCCCCAGG + Intronic
1141410556 16:83830053-83830075 CGGTCACCAGGCTCAACCGCAGG + Intergenic
1141682751 16:85553885-85553907 GGGTCCCCAGCGGCAGCCCCGGG - Intergenic
1141811473 16:86379033-86379055 CTGTCCCCAGGGGCACACACAGG + Intergenic
1143658940 17:8313018-8313040 AGGTCCCCAGGGTCCCCCGTCGG + Exonic
1143863607 17:9908463-9908485 CGGTCCCCTGGGGCCCCTCCTGG - Intergenic
1143983697 17:10893016-10893038 GGGTCCCCAGGACCACCCTCAGG - Intergenic
1147153193 17:38530286-38530308 GGGTCCCCAGGGGGCCCCCCGGG - Exonic
1147156774 17:38547989-38548011 CGGCCCCCAGCCTCACCCCTTGG + Intronic
1148733538 17:49851821-49851843 CTGTCCCCAGGGTCCCCACCAGG - Intergenic
1148751347 17:49947444-49947466 CCATCCCCAGGGTCAGCCCGAGG + Intergenic
1148776074 17:50096311-50096333 CCTGCCCCAGGGCCACCCCCAGG - Intronic
1149011692 17:51863652-51863674 TGGTCCCCACGGACACCCTCAGG + Intronic
1150435016 17:65147003-65147025 CAGTTCCCTGGGCCACCCCCAGG + Intronic
1150624884 17:66835290-66835312 CGTCCCCCAGGGACCCCCCCAGG - Intronic
1151540061 17:74760220-74760242 CCTGCCCCAGGCTCACCCCCCGG - Intronic
1151657526 17:75502756-75502778 CCGGCCCCAGGGCCACCTCCTGG - Exonic
1151947455 17:77327407-77327429 TGCTCCCCAGGGTCTCCCACTGG + Intronic
1152565341 17:81097812-81097834 CTGTCCCCAGGGACACACCCAGG - Intronic
1153900378 18:9613764-9613786 CGGGGCCCAGGCTGACCCCCGGG + Intronic
1154165618 18:12012231-12012253 AGGTCCCCAGGGCCCCTCCCTGG + Intronic
1157096831 18:44693287-44693309 GGCTCACCATGGTCACCCCCAGG - Intronic
1157724228 18:49951312-49951334 TGGCCCCCAGGACCACCCCCAGG - Intronic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1160788178 19:911705-911727 CGGACCCCAGGGGCGCACCCTGG + Intronic
1160799799 19:962473-962495 TGGTTCCCAGGGCCACGCCCTGG - Intronic
1160865575 19:1254472-1254494 CCTTCCCCAGGCTCACCTCCGGG - Exonic
1160975151 19:1789394-1789416 CGATGGCCAGGGTCACCACCTGG + Exonic
1161003542 19:1923352-1923374 CTGTCACCAGGGACACTCCCAGG + Intronic
1161087760 19:2343063-2343085 GGGTCCTCAGAGTCATCCCCTGG + Intronic
1161169799 19:2807093-2807115 AGGTTCTCAGGGTCACCCCAGGG + Intronic
1163214138 19:15863568-15863590 GTGTCACCATGGTCACCCCCAGG + Intergenic
1163654589 19:18538378-18538400 CCGTCTTCAGGGTCACCTCCAGG + Exonic
1164526006 19:29014316-29014338 CAGTCTCCAGCCTCACCCCCTGG + Intergenic
1164620502 19:29693107-29693129 CGGTCCCCAGAGGCAGCCCCAGG + Intergenic
1165094160 19:33401550-33401572 AGGTCTCCAGGGTCACTCCTAGG - Intronic
1165330763 19:35140178-35140200 CGGTCCCCACCGCCACCCCTGGG - Intronic
1165789829 19:38484618-38484640 AGGGACCCAGGGTCATCCCCAGG + Intronic
1166801630 19:45461214-45461236 TTGGCCCCAGGGACACCCCCTGG - Intronic
1166963486 19:46513929-46513951 TGCTCCCCAGTGTCAGCCCCGGG + Intronic
1167383343 19:49150722-49150744 CGGTCCCCCGGGTCATCTGCGGG + Exonic
1167493149 19:49803185-49803207 CAGTCCCCCGGGACACACCCAGG - Exonic
1167573490 19:50305511-50305533 CAGTCCACAGGGTCACCCAGGGG + Intronic
1167594057 19:50418259-50418281 GGGTCCCCAGGGTCATCACCAGG - Intronic
926047239 2:9718564-9718586 CCGGCCCCAAGGTCACCCCCAGG - Intergenic
928971212 2:37031271-37031293 GAGTCCCCAAGATCACCCCCAGG - Intronic
930734081 2:54757466-54757488 CATACCCCACGGTCACCCCCAGG - Intronic
933774138 2:85761687-85761709 CAGTCCCCAGAGTCTCCCTCAGG + Intronic
934751196 2:96795263-96795285 CGGACCCCAGGGTCCCGGCCTGG + Intronic
936262347 2:110972475-110972497 CGGTCCCCAGGGTCACCCCCAGG + Intronic
946399140 2:219459683-219459705 CCTGCCCCAGGGTCACCTCCAGG - Intronic
947994557 2:234515977-234515999 GGGTCCCCAGGACCACCCCCAGG - Intergenic
1169537404 20:6560101-6560123 GGTTCCCCAGGATCACCCTCAGG - Intergenic
1170999390 20:21397267-21397289 CGGCCCCCAGGGGCGCCCCCAGG + Exonic
1171490099 20:25510774-25510796 CCGTCCCCAGCAGCACCCCCTGG - Intronic
1173582156 20:44154958-44154980 CAGTCCCCAGGCTCACTTCCCGG + Intronic
1173656361 20:44702923-44702945 GGATCCCCTGGGACACCCCCAGG - Intergenic
1173900863 20:46588041-46588063 GGGTCCCCAGAGTCTCACCCAGG + Exonic
1174587286 20:51618938-51618960 GGGTCCCCAAGCTCACCTCCAGG + Exonic
1175337259 20:58204818-58204840 CCATCCCCAGGGTCTCCTCCTGG + Intergenic
1175632757 20:60556102-60556124 GGGTCCCCAAGCTCAGCCCCAGG - Intergenic
1175898805 20:62351909-62351931 GGGACCCCACGGTCACCCGCCGG - Exonic
1175998003 20:62819959-62819981 CGTTCCCCAGGGGCACCCTTGGG - Exonic
1176072880 20:63235978-63236000 CTGTCCCCAGGGTGGGCCCCGGG + Exonic
1176307937 21:5134017-5134039 TGGACACCAGCGTCACCCCCGGG - Exonic
1178508240 21:33180513-33180535 CCTTCCCCAGGGTCACACACTGG - Intergenic
1178508285 21:33180724-33180746 CCTTCCCCAGGGTCACACACCGG - Intergenic
1178786212 21:35656143-35656165 CTGTCGGCAGAGTCACCCCCTGG - Intronic
1178972804 21:37195825-37195847 CTGTTGCCAGGGCCACCCCCTGG + Exonic
1179434390 21:41350247-41350269 CGCTCCCCAGGGTCAGCCTGAGG - Intronic
1179849124 21:44128013-44128035 TGGACACCAGCGTCACCCCCGGG + Exonic
1179999092 21:44987068-44987090 CGGCCCCCAGCATCACCCCCAGG - Intergenic
1180061728 21:45388728-45388750 CAGTCCCCAGGTTCATCCACAGG + Intergenic
1180260763 21:46667407-46667429 CCGTCCCCCGGGGCACCCCGAGG + Intergenic
1180622465 22:17171404-17171426 CTGTCCGCAGGGTCCCCTCCCGG - Intergenic
1181542877 22:23583333-23583355 CTGCCCCCAGGGACACACCCGGG - Intergenic
1181946976 22:26525614-26525636 GGGTCCCCAGGGCCACCCCCAGG - Exonic
1182558169 22:31140294-31140316 AGCCCCCCAGGGCCACCCCCAGG + Exonic
1183405705 22:37629641-37629663 CAGGCCCCTGGGCCACCCCCTGG - Intronic
1183454193 22:37912528-37912550 ACATCCCCAGGGCCACCCCCTGG - Intronic
1184428008 22:44424418-44424440 CTGTCCCCAGGGTCTTCCCCTGG - Intergenic
1184477569 22:44729847-44729869 CGGTGCCCAGAGCCACCCCCCGG + Intronic
953404515 3:42653978-42654000 GGGACCCCAGACTCACCCCCAGG + Intronic
954117212 3:48473483-48473505 AGGGCCCCAGGGTCGCCCTCTGG - Intronic
954135321 3:48579652-48579674 CGGTCCCCAGGCTCTCCCTGTGG + Exonic
954135796 3:48581574-48581596 CGGTCTCCAGGGTCTCCCTTGGG + Exonic
960687370 3:120307569-120307591 CGGTCCTCATGATCTCCCCCTGG - Intergenic
961452516 3:127008812-127008834 TGGCCCCCAGCGTCACCCTCTGG + Intronic
962808142 3:138941199-138941221 AGGGCCCCAGGGTCACCACCAGG + Intergenic
967263529 3:187669833-187669855 CGCTTCCCAGGGTCAGCACCAGG + Intronic
968459674 4:718267-718289 CGGCCCCCAGCGCCGCCCCCGGG - Intronic
968620324 4:1601018-1601040 CGCCCCCCAGGGCCACGCCCAGG + Intergenic
968668160 4:1832957-1832979 TGGTCACAAGGGTCATCCCCGGG + Intronic
968727669 4:2255819-2255841 CGGTGCCCTGGGTCCCCCTCTGG - Intronic
968883078 4:3311082-3311104 CGGCCTCCAGGGTGACCCCACGG - Intronic
968886280 4:3335515-3335537 CTGTCCCCAGGGGCGCTCCCCGG + Intronic
969587752 4:8104339-8104361 GGGGACCCAGGGACACCCCCAGG - Intronic
969707106 4:8817996-8818018 CTGTCCCCAGAGACAGCCCCAGG + Intergenic
969726478 4:8921143-8921165 AGGTCCCCAGGCTCACTCCCAGG - Intergenic
972719178 4:41678591-41678613 CTGTTACCAGGGTCACCCCTTGG - Intronic
981311191 4:143299571-143299593 GAGTCCCCAGGGACACCTCCCGG + Intergenic
981516920 4:145619490-145619512 CGGTCCTCCGGGGCGCCCCCTGG + Intronic
983656552 4:170090213-170090235 CGGTCCCCTCGGTCAGCCCCTGG - Intronic
985680711 5:1254241-1254263 AGGCCCCCAGGGTCAGGCCCGGG + Intronic
985692761 5:1322715-1322737 CGGTGCCCAGGGCTCCCCCCAGG - Intronic
985725338 5:1513158-1513180 CGGTCCCCAGGCTGGCCTCCGGG + Intronic
988555920 5:32235945-32235967 CGGTCCCCAGGGTCTCACACAGG + Intronic
989031843 5:37127260-37127282 GGGTCCCCAAGATCACCTCCAGG - Intronic
991557157 5:67908528-67908550 TGGTCCCCAGGGTCATCAGCAGG + Intergenic
997353760 5:133249109-133249131 CTGTTCTCAGGGTCACCTCCAGG + Intronic
997698147 5:135877816-135877838 GTGTCCCCATGGCCACCCCCAGG - Intronic
998265565 5:140665145-140665167 CTGTTCCCAGGTCCACCCCCGGG - Intronic
999389847 5:151182076-151182098 AGGTCCCCAGCTTCAGCCCCAGG - Exonic
1001484748 5:172111407-172111429 AGGTCCCCAGGGCCTCCCTCAGG + Intronic
1001745604 5:174090112-174090134 CGGTCCCCAAGACCATCCCCAGG + Intronic
1003128279 6:3373456-3373478 GGGTCCCCAAGACCACCCCCAGG - Intronic
1003405919 6:5827289-5827311 CGGTCCCGTGGGCCTCCCCCAGG - Intergenic
1004189320 6:13450384-13450406 GGGTCTCCAAGATCACCCCCAGG + Intronic
1006189255 6:32197457-32197479 CTGTCCCCAGGCTCACACCGTGG - Exonic
1006375244 6:33668320-33668342 CGGACCCCAGGGTGATGCCCTGG + Intronic
1007800475 6:44387986-44388008 GGGCCCCAAGGGTCAGCCCCCGG - Intronic
1008487300 6:52050198-52050220 CGGTCTACAGTGTCACCTCCTGG - Exonic
1010444294 6:75933715-75933737 TGATCCCCAGGGTCACTCCAGGG - Intronic
1014417808 6:121205701-121205723 AGGTGCCCAGGCTCAACCCCAGG + Intronic
1016003436 6:139066192-139066214 GGGTCCCCAGAGCCACCCCTTGG + Intergenic
1017605792 6:156131447-156131469 TGTTCCCCAGGGTCACCCTGTGG + Intergenic
1019412492 7:912360-912382 CTGTCACCAGGGTCACCCCCAGG + Intronic
1019457468 7:1138039-1138061 CGGACCCCAGGGCCGCCGCCCGG + Exonic
1019485518 7:1287581-1287603 GGGCCCCCAGGGTCACAGCCTGG - Intergenic
1019894476 7:3972921-3972943 CCGTCTCCAGGGTGGCCCCCAGG - Intronic
1022350713 7:29564424-29564446 AGCACCCCAGGGTGACCCCCGGG - Intronic
1023358058 7:39387129-39387151 AGGAACCCAGGGTCACCCACTGG + Intronic
1024291455 7:47807482-47807504 AGGGCCCCAGGGCCACCCCCAGG - Intronic
1025987466 7:66466247-66466269 CAGTCCCCAGGGCTGCCCCCAGG - Intergenic
1026027529 7:66759175-66759197 CAGTCCCCAGGGCTGCCCCCAGG + Intronic
1027052194 7:75027561-75027583 CAGTCCCCAGGAGCAGCCCCAGG - Intronic
1027190428 7:75993186-75993208 AGGCCCCCAGGGCCACCTCCTGG + Intronic
1029359672 7:100079469-100079491 CGGTCCCCACGGGCAGCACCAGG - Intronic
1032390504 7:131552558-131552580 GGGTCCTCAGGGTGTCCCCCAGG - Intronic
1035056600 7:156040220-156040242 GGGTCCCCAGGGACGCCCCCAGG - Intergenic
1035661606 8:1352350-1352372 CTGTCCCCAGCGACTCCCCCTGG + Intergenic
1035813410 8:2512840-2512862 GAGTCTCCAGGGTCTCCCCCAGG - Intergenic
1035913791 8:3597224-3597246 CGGGCCCCAGGGGTACACCCAGG + Intronic
1036016163 8:4787209-4787231 CGGCCCCCAGGCGCGCCCCCTGG - Intronic
1036525571 8:9531227-9531249 GGGTCCCCAGGACTACCCCCAGG - Intergenic
1036768749 8:11564789-11564811 CGGCCCACAGCGTCAGCCCCTGG - Intergenic
1045051392 8:98329971-98329993 CTGTCCCCAGGGCCATGCCCAGG - Intergenic
1046246064 8:111564521-111564543 CTTTCCCCAAGGTCACCCCTGGG + Intergenic
1049441296 8:142610952-142610974 GGGTCTCCAGGGTGACCCTCTGG + Intergenic
1049744294 8:144256640-144256662 CGGGCCCCACGCCCACCCCCAGG + Intronic
1049757511 8:144317302-144317324 CAGCCCCCAGGGACACCCCAGGG + Intronic
1052963196 9:34318439-34318461 CGGTCGCCAAGGCCACCGCCAGG - Intronic
1056885871 9:90443265-90443287 CTCTCCCCAGGGTCTCTCCCAGG + Intergenic
1056963326 9:91145651-91145673 TGGGGCCCAGGGTCAGCCCCGGG + Intergenic
1057157838 9:92859706-92859728 GGGTCCCCAGGACCACCCTCAGG + Intronic
1057892842 9:98882158-98882180 GAGTCCCCAGGGTCACCACTAGG - Intergenic
1058862465 9:109129230-109129252 AGGCCCCCAGGGTGAGCCCCAGG + Intergenic
1060742239 9:126106939-126106961 TTGTCCCCAGGGTCACCGACCGG - Intergenic
1060985653 9:127817629-127817651 ACGCCCCCAGAGTCACCCCCAGG - Intronic
1061220243 9:129246433-129246455 CGGTGGCTCGGGTCACCCCCGGG + Intergenic
1062138824 9:134944293-134944315 TGGTCCCCAGGTCCAGCCCCTGG - Intergenic
1062380269 9:136283726-136283748 CTGTCCCCAGGGCCAGACCCAGG - Intronic
1062534422 9:137015227-137015249 GGGTCCTCAGCGTCACCCCCTGG - Intronic
1203551424 Un_KI270743v1:166970-166992 CGTACCCCAGGGTCACACCAGGG + Intergenic
1185489246 X:508249-508271 TGGACCCCAGGGCCACCCCTAGG - Intergenic
1185670225 X:1803649-1803671 GTGTCCCGAGGATCACCCCCTGG + Intergenic
1185763885 X:2708860-2708882 CCGCCACCAGTGTCACCCCCAGG - Intronic
1190064338 X:47229820-47229842 CAGTCTCCAGGGTCAGTCCCTGG + Exonic
1196910458 X:120479522-120479544 CAGTCCCCTGGGTCCCACCCAGG - Intergenic