ID: 936265063

View in Genome Browser
Species Human (GRCh38)
Location 2:110998439-110998461
Sequence TTCACTTAAAGGAGCCGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936265063_936265066 -6 Left 936265063 2:110998439-110998461 CCAGTGCGGCTCCTTTAAGTGAA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 936265066 2:110998456-110998478 AGTGAACCCACAGCAAGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936265063 Original CRISPR TTCACTTAAAGGAGCCGCAC TGG (reversed) Intronic
903223593 1:21882685-21882707 TTCAATTTAAAGAGCCACACAGG + Intronic
907537857 1:55181462-55181484 TTCACTTAAAGGAACCTGATAGG + Intronic
911638828 1:100266130-100266152 TCGGCTTAAAGGAGCCGCGCTGG - Intergenic
914930247 1:151924765-151924787 TTTACTTAGAGGAGCTGCCCTGG - Intergenic
918932119 1:190867670-190867692 TTTACTTAAAGGATTCACACAGG + Intergenic
1068205402 10:53844248-53844270 TACATTTAAAGGAGGCACACTGG + Intronic
1076232453 10:128832871-128832893 TTCACAGAAAGGAGTGGCACAGG - Intergenic
1079837357 11:25350911-25350933 TTCTCATAAGGGAGCTGCACTGG + Intergenic
1082823493 11:57560918-57560940 TTCACTTAAAGCACCAGCACCGG - Intronic
1084709212 11:70833627-70833649 GTCACTTCAAGGAGCTGCTCAGG + Intronic
1087132212 11:94678093-94678115 TTCACTGACAGGAGCTACACAGG - Intergenic
1092996050 12:13951826-13951848 TTCCCTTACAGAAGCCACACAGG - Intronic
1093554423 12:20453603-20453625 TTCGCTTAAAGGAGCCAGAGAGG + Intronic
1103003774 12:117406038-117406060 TTCACCTAAAGGAGCTGGTCTGG - Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1110790776 13:79584460-79584482 TTTACTTCCAGGAGCCCCACTGG + Intergenic
1112446831 13:99471936-99471958 TTCACATAAAGGAGCTTCAGGGG - Intergenic
1114640339 14:24215548-24215570 TTACCTTGAAGCAGCCGCACCGG + Exonic
1121610381 14:95274617-95274639 TTCCCTTCAAGGAGCCACACAGG - Intronic
1138394479 16:56693263-56693285 TTTACTTATAGGAGCTTCACTGG + Intronic
1142954243 17:3510237-3510259 TTCAATAAAAGGAGACTCACGGG - Intronic
1151241748 17:72763790-72763812 TTCACTTGAAGGAGCCAGAAAGG + Intronic
1163507936 19:17719436-17719458 GCCTCTTAAAGGGGCCGCACCGG - Exonic
930329135 2:49960392-49960414 TTCTCTTAGAGCAGCCACACTGG - Intronic
936265063 2:110998439-110998461 TTCACTTAAAGGAGCCGCACTGG - Intronic
945139705 2:206671397-206671419 TTCACTCAAAGGGGCTGCAAAGG - Intronic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
967713678 3:192738934-192738956 AACCCTTAAAGGAGCTGCACTGG - Intronic
971812029 4:31439078-31439100 TTCACCTAGTGGACCCGCACGGG - Intergenic
972087573 4:35239349-35239371 TTCACTTAGAGAAGCCTCATAGG - Intergenic
984782114 4:183535248-183535270 TTTCCTTAAATGAGCCACACGGG - Intergenic
989577575 5:43002684-43002706 GTAACTTAAAGGGGCGGCACTGG + Intergenic
1001374289 5:171240446-171240468 TTCATTTTTAGGAGCCTCACAGG - Intronic
1007966960 6:46012241-46012263 TTAACTTTCAGGAGCCTCACTGG - Intronic
1015262157 6:131250447-131250469 TTCACTCCACGGAGCAGCACAGG - Intronic
1026298796 7:69079211-69079233 TTCACTCAATGGAGCCAAACAGG + Intergenic
1027645713 7:80795386-80795408 TTGATTTAAAGGAGCTGCTCTGG + Intronic
1031865590 7:127035784-127035806 TTCCCGTAGAGGAGCCACACAGG + Intronic
1043453453 8:80391698-80391720 TTTACCTAAAGGAGCCCCAGTGG - Intergenic
1046095992 8:109561329-109561351 TTCACTCAAATGAGCAGTACTGG - Intronic
1047574825 8:126141445-126141467 TTGACTTTATGGAGCTGCACAGG + Intergenic
1047793232 8:128226836-128226858 TTCACTTAGCGGAGCCCCTCAGG - Intergenic
1056840070 9:89991629-89991651 TTGACTCAGAGGAGCCACACTGG - Intergenic
1189126152 X:38449186-38449208 TCAACTTAAAGGAGCTGCAAGGG + Intronic
1198536679 X:137593591-137593613 TTCCCTGTAAGGAGCGGCACAGG - Intergenic