ID: 936267994

View in Genome Browser
Species Human (GRCh38)
Location 2:111024999-111025021
Sequence CACCACTAGCATCTGGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936267990_936267994 30 Left 936267990 2:111024946-111024968 CCAATTTTAAATGTACAACTAAC 0: 1
1: 0
2: 5
3: 62
4: 588
Right 936267994 2:111024999-111025021 CACCACTAGCATCTGGATATAGG 0: 1
1: 0
2: 0
3: 9
4: 76
936267991_936267994 8 Left 936267991 2:111024968-111024990 CCAGTTTTGACAAATGCATATGT 0: 1
1: 1
2: 2
3: 27
4: 274
Right 936267994 2:111024999-111025021 CACCACTAGCATCTGGATATAGG 0: 1
1: 0
2: 0
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936267994 Original CRISPR CACCACTAGCATCTGGATAT AGG Intronic
900843610 1:5078231-5078253 CACCACTAGCAGCTGGGGAGAGG + Intergenic
907234895 1:53037609-53037631 CACCACTTGCTTTTGGACATCGG - Intronic
907734624 1:57100110-57100132 CACCACTAGCTACGGGATCTTGG + Intronic
1067103181 10:43348058-43348080 CCCCACTGGCATCTTGATACAGG - Intergenic
1068624450 10:59226333-59226355 AACCACCAGTATCTGTATATTGG - Intronic
1068731513 10:60363425-60363447 AACCACTTGTATCTGGATAGAGG + Intronic
1071338214 10:84619197-84619219 CAGCTCTAGCATCTGGTTATGGG - Intergenic
1071354658 10:84782450-84782472 CACCAATATTATCTGGATGTAGG + Intergenic
1071512081 10:86268343-86268365 CACCAACAGCATTTGGATACTGG + Intronic
1072859934 10:98992962-98992984 CAGAACTAGAAACTGGATATTGG - Intronic
1076553221 10:131301136-131301158 CAGCACTTGCAACTGGATAGTGG + Intronic
1084496561 11:69508094-69508116 CACCACCAAGATCTGGCTATAGG + Intergenic
1090987132 11:131778161-131778183 CAACACACCCATCTGGATATTGG - Intronic
1098626549 12:72678178-72678200 AACCATTTGCAACTGGATATAGG + Intergenic
1099663750 12:85599349-85599371 ATCCACCAGCATCTAGATATGGG + Intergenic
1100208272 12:92375065-92375087 CATCAGTAGCACCTGGAAATTGG - Intergenic
1103512232 12:121483309-121483331 CTCCACTAGCATCTTGAGACTGG - Intronic
1113441730 13:110334339-110334361 CACCACCACCATCTGCATGTTGG + Intronic
1114819869 14:26005852-26005874 CAGCACTAGCATTTGAAAATGGG - Intergenic
1126722734 15:51599312-51599334 CACAACTGGCATCTAGATCTTGG - Intronic
1129987597 15:79932368-79932390 CTCCACTACCTTCTGGCTATGGG - Intergenic
1130721355 15:86388284-86388306 TAGCACTAGCATCTGAATATTGG + Intronic
1131640515 15:94287835-94287857 CACTGCTAACATCTGGATCTGGG - Intronic
1133331348 16:4976607-4976629 CACAATTAGCATCTGGAGATGGG - Intronic
1140243747 16:73229432-73229454 CTCAACTCCCATCTGGATATAGG + Intergenic
1140909705 16:79440128-79440150 CACCACTACCACCTGGATGCAGG + Intergenic
1143181869 17:4988372-4988394 CACCACTAGCCTCTCGGCATCGG + Exonic
1144277458 17:13687441-13687463 CACATCTAGCATCTAGATTTTGG - Intergenic
1147026772 17:37592848-37592870 CACAACCAGCATATGGACATTGG - Intronic
1148852960 17:50563581-50563603 CTCCACTAGCACCTGGAGATAGG - Intronic
1151006607 17:70445005-70445027 CACAACTAGCATCCAGATTTTGG + Intergenic
1151423490 17:74014403-74014425 CACCACGAGCATCTGGGTCTTGG + Intergenic
1153410403 18:4786285-4786307 CACCACTTGAATCAAGATATAGG - Intergenic
1153748635 18:8207029-8207051 CTCTACCAGCATCTGGATTTGGG + Intronic
1159183741 18:64944111-64944133 CACCACTATTATCTGGACCTGGG - Intergenic
1163724211 19:18913335-18913357 CACCTCTAACCTCTGGACATGGG + Intronic
1164742225 19:30584218-30584240 CACCACTTGCAGCAGGATACAGG - Intronic
929321583 2:40550260-40550282 CCCCACCAGCATCTGCATATTGG - Intronic
931203001 2:60118697-60118719 CACAGCTAGCATTTGGATTTTGG + Intergenic
932650668 2:73552387-73552409 TGCCACTAGCATATGGATAGTGG - Intronic
936267994 2:111024999-111025021 CACCACTAGCATCTGGATATAGG + Intronic
936327834 2:111520912-111520934 CAACTTTAGAATCTGGATATTGG + Intergenic
936694634 2:114931303-114931325 CAGCACTAGCATCTGCATCTGGG + Intronic
938153531 2:128907186-128907208 CACCACTACAATCAGAATATGGG + Intergenic
940928833 2:159401935-159401957 TACAACTAGCATCTGGAGATGGG - Intronic
947490438 2:230590168-230590190 GACCCCAAGCATTTGGATATAGG + Intergenic
1173323900 20:42015305-42015327 CAACTCTAGCATCTGAATTTTGG - Intergenic
1178987721 21:37322529-37322551 CACTACTAGCATGTGGCTAGTGG - Intergenic
1183497967 22:38160939-38160961 CACCACTCGAATCTAGAGATAGG - Intronic
949128356 3:472522-472544 CTCCACTAGCATCTTGATCTTGG - Intergenic
949659505 3:6261664-6261686 CATCACTAGCATCTGGCAAATGG - Intergenic
956819611 3:72941917-72941939 CACACCTAGCACCTAGATATTGG + Intronic
957884255 3:86263635-86263657 CACTAAAAGCATCTGGAAATTGG - Intergenic
961732166 3:128973700-128973722 AACCACTAGCATCTAGCAATGGG + Intronic
964392587 3:156213083-156213105 CACCAGTAGGATCTGGTGATGGG + Intronic
965173044 3:165293648-165293670 AACCACCAGCATCTGGAATTAGG - Intergenic
967287462 3:187887314-187887336 CACCACTATACTCTGGATACAGG + Intergenic
969667766 4:8571816-8571838 CACCAGTAGAATTTGGAGATGGG - Intronic
971259913 4:25046723-25046745 CACCACTTGGATCTTGATCTTGG - Intergenic
973547545 4:51996549-51996571 AACCACTAGAATCTGGAGCTGGG - Intronic
974091215 4:57313427-57313449 CTCCAATAGCATCTGAAAATAGG + Intergenic
974542225 4:63251790-63251812 CAACAGTAGCAGCTGGAAATAGG - Intergenic
975510551 4:75190131-75190153 CACCAGTAGCCTCTGTCTATGGG - Intergenic
984554926 4:181202280-181202302 TACCCCTATCATCTGGATGTAGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
998337191 5:141383576-141383598 CACCACTGTCACCTGGATGTGGG - Exonic
1000711068 5:164579467-164579489 TACTGCCAGCATCTGGATATAGG - Intergenic
1004843806 6:19615561-19615583 CACCACTAGGGCCTGAATATTGG + Intergenic
1008979181 6:57463770-57463792 CACCACCACCATCTGAAGATGGG - Intronic
1011851453 6:91634629-91634651 AATCATTTGCATCTGGATATAGG + Intergenic
1012073721 6:94657288-94657310 CACCACTACCATCAGCCTATGGG + Intergenic
1015909679 6:138157525-138157547 CACCAGAAGAATCTGCATATAGG + Intergenic
1017084892 6:150704800-150704822 CCCCACTAGCACCTTGATCTTGG - Intronic
1018189769 6:161300385-161300407 CCCTGCTAGCATCTTGATATCGG - Intergenic
1019984886 7:4648370-4648392 CATCACTGGGATCTGGATGTTGG - Intergenic
1024732598 7:52269932-52269954 CACCACAAATATCTGGACATTGG + Intergenic
1030099743 7:105934938-105934960 CACCACTAGCCTCTTACTATGGG - Intronic
1037599150 8:20379265-20379287 ACCCACTAGCATGTGGACATAGG - Intergenic
1039471141 8:37814495-37814517 CACCACTCTCTTCGGGATATTGG + Intronic
1040698201 8:50028060-50028082 CACCACTGGCATCAATATATGGG + Intronic
1048434776 8:134405962-134405984 CAACACTAACAGCTGGATAAGGG - Intergenic
1058476225 9:105336593-105336615 CAGCACTAGCCTGTGGATCTGGG - Intronic
1186930489 X:14383859-14383881 CACAACTAGGATATTGATATCGG + Intergenic
1190462768 X:50695033-50695055 CACCAAAAGCATCTGCCTATTGG - Intronic
1190754229 X:53387581-53387603 AGCAACTACCATCTGGATATTGG - Intronic
1196021735 X:110997939-110997961 CACCACCAGCACCTTGATCTTGG + Intronic