ID: 936271418

View in Genome Browser
Species Human (GRCh38)
Location 2:111052294-111052316
Sequence GTGTGCTCTCATGGTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 283}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936271418_936271423 -1 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271423 2:111052316-111052338 CACGGGAGGTGTGACTGCAGTGG 0: 1
1: 0
2: 2
3: 18
4: 179
936271418_936271425 10 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271425 2:111052327-111052349 TGACTGCAGTGGAACCATGAGGG 0: 1
1: 0
2: 0
3: 60
4: 1130
936271418_936271428 22 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271428 2:111052339-111052361 AACCATGAGGGGTACTGTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 123
936271418_936271424 9 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271424 2:111052326-111052348 GTGACTGCAGTGGAACCATGAGG 0: 1
1: 0
2: 1
3: 22
4: 216
936271418_936271427 19 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271427 2:111052336-111052358 TGGAACCATGAGGGGTACTGTGG 0: 1
1: 0
2: 2
3: 7
4: 112
936271418_936271426 11 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271426 2:111052328-111052350 GACTGCAGTGGAACCATGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 183
936271418_936271430 26 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271430 2:111052343-111052365 ATGAGGGGTACTGTGGTGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936271418 Original CRISPR GTGTGCTCTCATGGTGCTGA AGG (reversed) Intronic
900540042 1:3197995-3198017 ATGTGCTCTCAGGGTGCTACGGG + Intronic
902178184 1:14667271-14667293 ATGTGCTCTGAGGATGCTGATGG - Intronic
902657141 1:17876989-17877011 ATGTTCACTCATGGGGCTGAGGG + Intergenic
902998668 1:20248495-20248517 GTAAACTGTCATGGTGCTGATGG - Intergenic
903066825 1:20704306-20704328 CTGCGCTCACATGGGGCTGAGGG + Intronic
904583164 1:31562893-31562915 GTCAGCTGTCATGGTGCTGGTGG + Intergenic
906277449 1:44527268-44527290 GTGTGGTTAGATGGTGCTGATGG - Intronic
908771860 1:67604794-67604816 GATTCCTCTCTTGGTGCTGAAGG + Intergenic
909268266 1:73590294-73590316 GTAAGCTGTCATGGTGCTGGTGG + Intergenic
910517299 1:88076175-88076197 TTGTGCACTCATGGTGCTTGAGG + Intergenic
911410139 1:97493805-97493827 GTGTGCTATCATTTTGCTGCGGG - Intronic
912218297 1:107642309-107642331 GTAAACTGTCATGGTGCTGATGG - Intronic
913383788 1:118238107-118238129 GTGAGTTCTCATGAAGCTGATGG + Intergenic
913500501 1:119468466-119468488 GTGGGCTCTGATTGTGCAGAGGG + Intergenic
916532783 1:165674106-165674128 GTAAACTGTCATGGTGCTGATGG - Intronic
917293998 1:173500081-173500103 GTAAACTGTCATGGTGCTGATGG - Intergenic
917539322 1:175897891-175897913 GAGGGGTCTCAGGGTGCTGAGGG + Intergenic
918341764 1:183573574-183573596 GGGTTCTCTCATGGTGTAGAGGG + Intronic
918388709 1:184036865-184036887 GTGTGCGCAGAGGGTGCTGATGG - Intronic
918847410 1:189635409-189635431 GTGTGCTCTCATTGTGCCACTGG - Intergenic
920624133 1:207579539-207579561 GTAAACTGTCATGGTGCTGATGG - Intronic
922236805 1:223728180-223728202 GTTCTCTCTCATGGTTCTGAAGG + Intronic
922563039 1:226582775-226582797 TTGTTCTCTGATGGAGCTGAGGG + Intronic
922773698 1:228205326-228205348 GTGTGTTCTCTCGGTGCTGCTGG + Intronic
923479028 1:234365482-234365504 GTGTGCTCTCCTGTCACTGAAGG + Intergenic
1063882096 10:10541630-10541652 GTAAACTGTCATGGTGCTGATGG + Intergenic
1065209170 10:23386630-23386652 GTGTCCTCACATGGTGAAGAGGG + Intergenic
1065774616 10:29107788-29107810 GTCTGATTCCATGGTGCTGAAGG - Intergenic
1066358981 10:34712357-34712379 GCCTGCTTTCATGGTGCTGATGG - Intronic
1068100029 10:52541220-52541242 ATGTGTGCTCATGGTCCTGAAGG - Intergenic
1070916308 10:80157405-80157427 GTGTTCTCTGATGCTGCTGGGGG + Intronic
1071331633 10:84566326-84566348 GTGAACTGTCATGGTGCTGGTGG - Intergenic
1071779098 10:88823003-88823025 GTGAGCTCTCACCATGCTGAGGG + Exonic
1073744518 10:106450524-106450546 GTGTTCTCTCATAGTGTTGGAGG - Intergenic
1073748103 10:106493132-106493154 GTAAACTGTCATGGTGCTGATGG + Intergenic
1076023455 10:127092969-127092991 GTGTTCTCTCATTGTTCTGGAGG + Intronic
1076713187 10:132350359-132350381 TTGTGGTCTCAGGGTCCTGAGGG - Intronic
1076803515 10:132843881-132843903 GGGTGTTCTCAGGGTGCTGTGGG + Intronic
1076987190 11:246666-246688 GAGTACTCATATGGTGCTGAGGG - Intronic
1077138549 11:1013423-1013445 GCCTGCTCTCCTGGGGCTGAAGG - Exonic
1077152237 11:1077556-1077578 GGATGCACTCATGGTGCTCAGGG + Intergenic
1077316863 11:1923249-1923271 GTGTGGCCACATGGTCCTGAGGG + Intronic
1085530891 11:77191417-77191439 GAATCCTCTCCTGGTGCTGAAGG + Intronic
1087106281 11:94411125-94411147 AGGTGCTCTCATGTTGCTGGTGG + Intergenic
1090603298 11:128394733-128394755 CTGTGCTATCTGGGTGCTGATGG - Intergenic
1094063720 12:26341762-26341784 GTCTGCTCTCAAGGAGCTTATGG + Intronic
1095799612 12:46258074-46258096 GTAAGCTGTCATGGTGCTGGTGG + Intronic
1097408286 12:59218945-59218967 CTGAGCTCACATGGTGTTGATGG + Intergenic
1102130347 12:110523783-110523805 GAGTGCTGTAATGGTGCTCATGG - Intronic
1104030608 12:125063452-125063474 GTAAACTGTCATGGTGCTGATGG + Intergenic
1105242690 13:18621803-18621825 ATGTGCTATCATGGTGGTAAAGG - Intergenic
1105468359 13:20668669-20668691 ATGTGCTCTCATTATGCTCAGGG - Intronic
1106663139 13:31823714-31823736 GTAAACTGTCATGGTGCTGATGG - Intergenic
1107409638 13:40146653-40146675 GTTTGCCCTCAGGGTGCTGCAGG + Intergenic
1108507744 13:51128061-51128083 GTAAACTCTCATGGTGCTGATGG - Intergenic
1108677600 13:52750684-52750706 GTGTCCTCACATGGTGGAGAGGG - Intergenic
1112064369 13:95776921-95776943 GTGTGCCCTGATGGTGCAGAAGG - Intronic
1112096606 13:96139314-96139336 GTGAGCTCTCTTGGTAATGAAGG + Intronic
1112583592 13:100697279-100697301 GTGAACTGTCATGGTGCTGGTGG + Intergenic
1113524449 13:110963905-110963927 GTGAACTGTCATGGTGCTGGTGG - Intergenic
1113681874 13:112250257-112250279 GTGTCCTGTCATGGTCCTGCAGG + Intergenic
1114849950 14:26371837-26371859 GTGTGTTTTCATGCTGCTGGTGG - Intergenic
1115773451 14:36689693-36689715 AAGTTCTCACATGGTGCTGATGG - Intronic
1116336721 14:43666154-43666176 GTGGCCACTCATGGTGCGGAGGG - Intergenic
1118636986 14:67757067-67757089 GTGTGCTGTAATGGTGATGGTGG - Intronic
1118767710 14:68921255-68921277 GTGTGCTCACACGCTGCTCAGGG + Intronic
1119691932 14:76679940-76679962 GTAAACTGTCATGGTGCTGATGG - Intergenic
1120373027 14:83662902-83662924 GTGAGCCCTCATTGTGCTGTGGG + Intergenic
1120697980 14:87665622-87665644 GTATTCTCTCATGGTTCTGGAGG - Intergenic
1120934678 14:89882906-89882928 ATGTGCTCTCTTGGGGTTGAGGG + Intronic
1122273363 14:100578240-100578262 GTGAGCTCCCATGGTGCACAGGG + Intronic
1122427811 14:101621845-101621867 GTGTTCTCTCTTGGGGCTGATGG - Intergenic
1122439040 14:101717660-101717682 GTGTCCTCTCACGGTTCTGGAGG - Intergenic
1122911184 14:104828361-104828383 GTAAACTCTCATGGTGCTGGTGG + Intergenic
1122940926 14:104981049-104981071 GGGTTCTCTCATCTTGCTGAAGG - Intergenic
1122949337 14:105032708-105032730 GTAAACTCTCATGGTGCTGGTGG - Intergenic
1123043584 14:105500491-105500513 GTGTGCCCCCATGATGCTGGCGG + Intergenic
1123123789 14:105930242-105930264 GTGTGCTCTTATGGGAATGAGGG + Intronic
1123488613 15:20762801-20762823 ATGTGCTGTCATGGTGGTAAAGG + Intergenic
1123545109 15:21331874-21331896 ATGTGCTGTCATGGTGGTAAAGG + Intergenic
1124440513 15:29682349-29682371 GTAAACTGTCATGGTGCTGATGG - Intergenic
1124698718 15:31892285-31892307 GTGTCTTCACATGGTGCAGAAGG + Intergenic
1125689852 15:41587127-41587149 GTAAGCTGTCATGGTGCTGGTGG - Intergenic
1126890810 15:53202231-53202253 CTGAACTCTCATGGTGATGATGG - Intergenic
1127114373 15:55709903-55709925 GTATGTTCTCATTGTGGTGATGG + Intronic
1127321717 15:57853076-57853098 GTGTCCTCACATGGTGGAGAAGG - Intergenic
1127842454 15:62843009-62843031 GTGTCCTCAGATGGTACTGAGGG + Exonic
1129904710 15:79178328-79178350 CTGTGCTCTCTTGGTGCAAATGG + Intergenic
1131452000 15:92549448-92549470 GTTTGCTGTCAAGATGCTGATGG + Intergenic
1132020526 15:98357970-98357992 ATGTGATCTCATGTTGCTGTGGG + Intergenic
1132366635 15:101262460-101262482 GTCTGCTGTCTTGGTGGTGATGG - Intergenic
1202953455 15_KI270727v1_random:59145-59167 ATGTGCTGTCATGGTGGTAAAGG + Intergenic
1133413302 16:5586241-5586263 GTATTCTCTCATAGTTCTGAAGG - Intergenic
1133421183 16:5648356-5648378 GTGTGATCAGAAGGTGCTGAAGG + Intergenic
1133435554 16:5776372-5776394 CCGTGGTCTCATGCTGCTGAAGG - Intergenic
1134000188 16:10776860-10776882 GTGAACTGTCATGGTGCTGGTGG + Intronic
1134077480 16:11302107-11302129 GTATTCTCTCATGGTTCTGGAGG + Intronic
1135610175 16:23859526-23859548 GTGTGCTGTAATGGTGGAGAGGG + Intronic
1136084170 16:27872756-27872778 GTAACCTCTCATGGTGCTGGTGG - Intronic
1136296551 16:29307317-29307339 TTGTGCTCTCCTGGTGCAGGAGG + Intergenic
1138590539 16:57997257-57997279 GTGTGCGCTCATGCTGCCGCAGG + Exonic
1139303820 16:65966700-65966722 CTGTGCTCTCATGGAGCTCATGG + Intergenic
1139964018 16:70735542-70735564 ATGTCCTCTCATGGTCCTGCCGG + Intronic
1142066729 16:88067232-88067254 GGCTGGTCTCATGGGGCTGAGGG + Intronic
1144169022 17:12640758-12640780 GTGTTTTCTCATGGTTCTGGAGG + Intergenic
1144185262 17:12790234-12790256 GTTTGCTCTGATTGTGCTGGAGG + Intronic
1144413864 17:15027299-15027321 GTGGCATCTCATGGTGATGATGG - Intergenic
1148933909 17:51149391-51149413 GTAAACTGTCATGGTGCTGATGG + Intergenic
1149378558 17:56069964-56069986 GTAAACTGTCATGGTGCTGATGG + Intergenic
1149530764 17:57393201-57393223 GAGTGCTGTCATGGTGCTCAAGG + Intronic
1149940859 17:60864227-60864249 GTCAACTGTCATGGTGCTGATGG + Intronic
1150803788 17:68302825-68302847 TTGTGCTCTGATGGAGCAGATGG + Intronic
1150896052 17:69212270-69212292 GTGTGTTTGCATGGTTCTGAGGG + Intronic
1151077690 17:71293227-71293249 GTAAACTGTCATGGTGCTGATGG - Intergenic
1152471435 17:80492042-80492064 GTGGCCTCTCCTGGTGCTGGAGG + Intergenic
1152862542 17:82704354-82704376 GTGTCCACTGATGGTTCTGATGG - Intergenic
1154446251 18:14438074-14438096 ATGTGCTATCATGGTGGTAAAGG + Intergenic
1155264346 18:24076450-24076472 GTGTCCTCTCATGGAGCTGCTGG + Intronic
1155577508 18:27264007-27264029 GTGTGTTCCCATGGTGTGGAGGG + Intergenic
1159447234 18:68555946-68555968 GTAAACTGTCATGGTGCTGATGG + Intergenic
1159602919 18:70445835-70445857 GTAAACTCTCATGGTGCTGGTGG - Intergenic
1159638901 18:70840083-70840105 GTAAACTCTCATGGCGCTGATGG + Intergenic
1159781736 18:72668024-72668046 CTGTGCTCTCATGGCTCTGCTGG - Intergenic
1160251198 18:77204813-77204835 GTGGGCTCTCATTGTTCTGAGGG + Intergenic
1160318290 18:77867922-77867944 GTAAGCTCTCATGGCGCTGGTGG + Intergenic
1161136281 19:2621901-2621923 GTGTCCTCTCACGGTTCTGGAGG - Intronic
1161640490 19:5419607-5419629 GTAAACTGTCATGGTGCTGATGG - Intergenic
1162883970 19:13682409-13682431 GTAAACTCTCATGGTGCTGGTGG + Intergenic
1164478733 19:28595160-28595182 ATGTGCTCTCTTGGTGCTGGGGG - Intergenic
1165341467 19:35215168-35215190 GTAAACTGTCATGGTGCTGATGG - Intergenic
1165476091 19:36032109-36032131 CTGTGCTCTGCTGGTGGTGATGG - Intronic
1166070001 19:40381398-40381420 GGCTGCACCCATGGTGCTGAAGG - Intronic
1166949947 19:46420381-46420403 GTATTCTCTCATGGTTCTGGAGG - Intergenic
1167800149 19:51735384-51735406 GTGTCCTCACATGGTGGTGGGGG + Intergenic
925316495 2:2930520-2930542 GGGTCTTCTCATTGTGCTGAGGG + Intergenic
925317538 2:2937433-2937455 GTGTACACTCAAGGTGATGACGG + Intergenic
926126502 2:10275551-10275573 GTAAACTGTCATGGTGCTGATGG + Intergenic
926369808 2:12168417-12168439 CTGTGCTCTCATTTTGCTCAGGG - Intergenic
926701120 2:15804304-15804326 GTGTTGCCTCATGGTGCTGTTGG - Intergenic
927576148 2:24203543-24203565 CTGCGCTCTCTTGGGGCTGAGGG - Exonic
929012159 2:37455917-37455939 GTGTCCTCACATGGTGGAGAAGG + Intergenic
929029080 2:37634173-37634195 GTCTGTTCTCATGCTGCTAATGG - Intergenic
929693792 2:44097160-44097182 CTGGCGTCTCATGGTGCTGATGG + Intergenic
930673818 2:54179059-54179081 GTGTCCTCACATGGTGCAAAGGG + Intronic
931150686 2:59569679-59569701 GTGTGGTCACATGGTGCAAAAGG + Intergenic
931645218 2:64416142-64416164 GTGTTCTCTCACAGTTCTGAAGG + Intergenic
933918781 2:87023464-87023486 CTGTGCTTTCACGATGCTGATGG - Intergenic
934004213 2:87746450-87746472 CTGTGCTTTCACGATGCTGATGG + Intergenic
934523161 2:95032534-95032556 GTGTACCCTCCTGGTGTTGATGG + Intronic
934888576 2:98046407-98046429 GTATACTGTCATGGTGCTGGTGG - Intergenic
935767171 2:106380464-106380486 CTGTGCTTTCACGATGCTGATGG + Intergenic
936271418 2:111052294-111052316 GTGTGCTCTCATGGTGCTGAAGG - Intronic
936791385 2:116157443-116157465 TTGAACTGTCATGGTGCTGAAGG + Intergenic
936819142 2:116497580-116497602 GTAAACTGTCATGGTGCTGATGG - Intergenic
939202644 2:139057738-139057760 GTGTTCTATCATGGTTCTGCTGG + Intergenic
940783491 2:157958378-157958400 GTGAGTTCTCATGGATCTGATGG - Intronic
941665680 2:168242138-168242160 ATGTGCTGTCATGGGGCTGGGGG - Intronic
945782296 2:214190743-214190765 GTGTCCTCTCAAGGTGAAGAGGG - Intronic
948263075 2:236618542-236618564 GTGTTCTCTCACAGTGCTGGAGG + Intergenic
948402982 2:237697611-237697633 GTGTGCTGCCCTGGTGCTGGTGG + Intronic
948433526 2:237936272-237936294 GTGTGCTGTCTTGATCCTGATGG - Intergenic
948591221 2:239051779-239051801 ATTTGCTCTCAAGGTGCTTATGG - Exonic
948681445 2:239637867-239637889 GTGTGATCTGATGGTACAGATGG - Intergenic
1168877864 20:1183876-1183898 GCCTGCTCTCAAGGTGCTCACGG - Exonic
1171199342 20:23228458-23228480 GTGTCCTCACATGGTGTTGGGGG - Intergenic
1172303146 20:33863594-33863616 GTGTGGCCTCAGGGGGCTGAGGG + Intergenic
1173003753 20:39124096-39124118 GTGTGGTCACATGGGGATGAAGG + Intergenic
1175058599 20:56220784-56220806 GTAAACTCTCATGGTGCTGGTGG - Intergenic
1175059452 20:56228523-56228545 GTGAACTGTCATGGTGCTGGTGG - Intergenic
1175855164 20:62117145-62117167 CTGTGCTCTCAGGGTGGTGAAGG + Intergenic
1175952916 20:62592837-62592859 GTGAGCCCTCATGGTGCACATGG + Intergenic
1176449730 21:6851772-6851794 ATGTGCTATCATGGTGGTAAAGG - Intergenic
1176827902 21:13716796-13716818 ATGTGCTATCATGGTGGTAAAGG - Intergenic
1177842042 21:26245615-26245637 GTAAACTCTCATGGTGCTGGTGG - Intergenic
1177911707 21:27041167-27041189 GTAAACTCTCATGGTGCTGGTGG - Intergenic
1179016663 21:37599946-37599968 GTATTCTCTCATGGTTCTGGAGG + Intergenic
1179255179 21:39709741-39709763 GTAAACTGTCATGGTGCTGATGG + Intergenic
1180414978 22:12700922-12700944 GTATACTCTGATGGTACTGATGG - Intergenic
1182088258 22:27576375-27576397 CTGGGCTCTCATGGTGCGGGGGG - Intergenic
1182126982 22:27822973-27822995 CAGTGCTCTCCTGGTTCTGAGGG - Intergenic
1183348965 22:37324186-37324208 GTGGGTTGTCCTGGTGCTGAGGG - Intergenic
1183376884 22:37470667-37470689 GAGGGCTCCCATGATGCTGAGGG - Intronic
1184013532 22:41767822-41767844 GAGTGCTCTCCTGGAGCTGGGGG + Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1185096523 22:48808972-48808994 GTATGTTCTCCTGATGCTGAGGG - Intronic
949943245 3:9170965-9170987 GTGCGCTGTCCTGCTGCTGAGGG - Intronic
950511426 3:13430536-13430558 GTAAACTGTCATGGTGCTGATGG + Intergenic
954131434 3:48563094-48563116 GTGTGCTCTGCTGTTGCTGATGG - Exonic
954786421 3:53096176-53096198 TTCTGCTCTCCTGGAGCTGACGG - Intronic
956765313 3:72479869-72479891 GTGTCCTCCCATGGTGAGGAAGG + Intergenic
956907398 3:73781088-73781110 GTAAACTCTCATGGTGCTGTTGG - Intergenic
959271327 3:104214472-104214494 GTGTCCCCTCATGGTGGTGGAGG + Intergenic
961096841 3:124164410-124164432 GTTTGCTCCCATGCTGCAGAAGG - Intronic
963047596 3:141114295-141114317 GTGTGCTCTCCTCCAGCTGAGGG + Intronic
964090672 3:152872737-152872759 GTGCGCTGTCATGATGATGATGG - Intergenic
964836749 3:160947606-160947628 CCCTGCTCTCATGGTGCTTATGG - Intronic
965454351 3:168879211-168879233 GTATTATCTCATGATGCTGAAGG - Intergenic
965969889 3:174542116-174542138 GTAAACTCTCATGGTGCTGGTGG + Intronic
968577532 4:1374879-1374901 GGGTGCTCACATGGTCCTCAAGG - Intronic
968927095 4:3555184-3555206 GTAAGCTGTCATGGTGCTGGTGG + Intergenic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
969622341 4:8284922-8284944 GTTTGCTCCCATGGTTCTGGAGG + Intronic
970247130 4:14075340-14075362 TTGTGATCTCATGGAGTTGATGG - Intergenic
971440641 4:26681163-26681185 ATGTGCTCTCGTGTTGCTGGTGG + Intronic
972353503 4:38259540-38259562 GTAAACTGTCATGGTGCTGATGG + Intergenic
973727036 4:53787213-53787235 GTATTCTCTCATAGTTCTGAAGG + Intronic
977674762 4:99734652-99734674 GTAAGCTGTCATGGTGCTGGTGG + Intergenic
977987884 4:103406142-103406164 GTGTTCTCTCACAGTGCTGGAGG + Intergenic
978044716 4:104112271-104112293 GTGTGGGCACATGGTGCTGTGGG - Intergenic
978520379 4:109609401-109609423 GTAAACTGTCATGGTGCTGATGG + Intronic
980466397 4:133189326-133189348 TTCTGCTCTCATTGTGCTTATGG + Intronic
981294504 4:143115618-143115640 GTGTTCTCTCACTGTTCTGAAGG - Intergenic
981853686 4:149262003-149262025 GTGTTCTCTCACGGTCCTGAAGG + Intergenic
984441230 4:179773638-179773660 GTGAACTGTCATGGTGCTGGTGG - Intergenic
985606887 5:862586-862608 CTGTGCCCTCATGGTGCGGCAGG - Intronic
985814627 5:2117427-2117449 GTGTCCTCTCTTGGTGGCGAGGG + Intergenic
985846596 5:2354154-2354176 CTGTGCTCTCTTGGTGCACATGG + Intergenic
989176803 5:38535655-38535677 GTTTGCTCTCAAGGATCTGACGG - Intronic
990723541 5:58726848-58726870 GTCTGCTCTCAAGGTGCTGGTGG - Intronic
992900249 5:81287563-81287585 GCTTTCTCTGATGGTGCTGAAGG - Intergenic
993835396 5:92813611-92813633 GTGTTCTCTCATGATGCTCATGG + Intergenic
993981021 5:94543841-94543863 GTAAACTGTCATGGTGCTGATGG - Intronic
995467915 5:112469912-112469934 GGGTGCTCTCATTGGGTTGATGG - Intergenic
995569336 5:113462867-113462889 CTCTGCTCTCATGGAGCTCAAGG + Intronic
995572472 5:113494874-113494896 GTGTCCTCCCATGGTGCAGAAGG + Intergenic
999807968 5:155101468-155101490 GTATGCTCTCATAGTTCTGGAGG - Intergenic
1000482264 5:161793153-161793175 GTTTGCTCTCTTGGTTTTGATGG - Intergenic
1001198062 5:169691480-169691502 GAGTGCTTTCATGGTGCAGTGGG + Intronic
1001510238 5:172315619-172315641 GTATACTGTCATGATGCTGATGG - Intergenic
1001578163 5:172778631-172778653 GTGTCATCTCATGGTTCTGGAGG + Intergenic
1002360708 5:178668581-178668603 GTGTTGTCTCATGGTCCTGGAGG + Intergenic
1002655094 5:180739704-180739726 GTGTGTGCTCCTGGTGGTGATGG - Exonic
1003720798 6:8700030-8700052 GTGTGATTTCAAGCTGCTGATGG - Intergenic
1006066572 6:31466610-31466632 AAGGGCTCTCATTGTGCTGAAGG - Intergenic
1006574978 6:35038407-35038429 GAGTGCTGTGATAGTGCTGATGG + Intronic
1007737768 6:43992435-43992457 GAGTGGTCTGATGGTGCTGGTGG + Intergenic
1011906964 6:92382782-92382804 GTGTGCTGCCATGGTTCCGAAGG - Intergenic
1012034248 6:94111294-94111316 GTGTGCTTTCATGATTGTGAGGG + Intergenic
1012976539 6:105786490-105786512 ATGTAGTCTCATGGTTCTGATGG - Intergenic
1016295710 6:142572075-142572097 GTAAGCTGTCATGGTGCTGGTGG - Intergenic
1018035481 6:159877808-159877830 GTATGCTCTCATTGTTCTGGAGG - Intergenic
1018127997 6:160700601-160700623 CTGTGCTTTCACGATGCTGATGG + Intergenic
1018148442 6:160915788-160915810 CTGTGCTTTCACGATGCTGATGG - Intergenic
1018367779 6:163139070-163139092 GTGTTCTCTCACAGTTCTGAAGG + Intronic
1018414076 6:163586330-163586352 GTGTGCTCTCCTGGGAATGATGG + Intergenic
1018954047 6:168396079-168396101 GTATCCTCTCATGGTTCTGGAGG + Intergenic
1020400353 7:7769872-7769894 GAGTGTGATCATGGTGCTGATGG - Intronic
1020454886 7:8360661-8360683 GTGTTCTCTCACAGTTCTGAAGG - Intergenic
1021662423 7:22933113-22933135 TTATTCTCTCATGGTTCTGAAGG - Intergenic
1022348100 7:29538213-29538235 GTGTCGTTTCATGGTGGTGAGGG - Intergenic
1023269040 7:38439590-38439612 GTGTACTCTAATTGTGATGAAGG - Intronic
1025606972 7:63046403-63046425 GGGTCTTCTCATGGTGGTGAGGG + Intergenic
1026306692 7:69148558-69148580 GTAAACTGTCATGGTGCTGATGG + Intergenic
1026493073 7:70880033-70880055 GTAAACTGTCATGGTGCTGAGGG - Intergenic
1026535122 7:71232829-71232851 GTGGGCTGTCATGGTGCTGATGG + Intronic
1027796205 7:82696617-82696639 GTAAACTGTCATGGTGCTGATGG + Intergenic
1027856136 7:83514107-83514129 GTAAACTGTCATGGTGCTGAAGG - Intronic
1029174883 7:98657663-98657685 GTGTCCTCTCACAGTGCTGGAGG - Intergenic
1031909051 7:127494603-127494625 GTGTCCTTACATGGTGCTTAAGG + Intergenic
1032461604 7:132115494-132115516 GTAAACTGTCATGGTGCTGATGG - Intergenic
1033603970 7:142911648-142911670 ATGTGCCCTCATGGAGCTGACGG - Intronic
1033944951 7:146705390-146705412 GTGTTCTCGCATGGTGGGGAGGG + Intronic
1034093781 7:148387957-148387979 ATAAGCTGTCATGGTGCTGATGG - Intronic
1035698744 8:1621673-1621695 GGCTGCCCTCCTGGTGCTGACGG - Intronic
1039083677 8:33758943-33758965 GTGTCCTCACATGGTGGTAAGGG + Intergenic
1039471855 8:37818360-37818382 ATGTGCTCTCATGAGACTGAAGG - Intronic
1039781049 8:40785991-40786013 GTGGGCTGTCAAGGAGCTGAAGG - Intronic
1040936645 8:52788662-52788684 GTCAGCTGTCATGGTGCTGGTGG + Intergenic
1041748045 8:61230894-61230916 GTGTGCTCACATAGTGGAGAGGG + Intronic
1042595842 8:70447271-70447293 GTGTGCTCTGATGCGACTGAGGG - Intergenic
1042794229 8:72643093-72643115 GTATGCTCTCATGGTGTTCCAGG + Intronic
1043096999 8:75988046-75988068 GTCAGCTGTCATGATGCTGATGG + Intergenic
1044438865 8:92199455-92199477 CTATGCTGTCATGGTTCTGAAGG + Intergenic
1048019094 8:130521732-130521754 GTGTCCTCTCATGGTGAAAAGGG - Intergenic
1048145159 8:131834527-131834549 TTGTTCTCTCATGGTTCTGGAGG - Intergenic
1048361807 8:133703845-133703867 CTGTGCCCTCATGGAGCTGGTGG + Intergenic
1049157894 8:141078097-141078119 GTTTATTCTCATGGTGCTGGAGG + Intergenic
1050620373 9:7446042-7446064 GTAAACTGTCATGGTGCTGACGG + Intergenic
1052460492 9:28756693-28756715 GTGAGTTCTCATGGTTCTGATGG + Intergenic
1053902723 9:42811117-42811139 GTGAGTTCTCATGGAGCTGATGG - Intergenic
1060492625 9:124096044-124096066 GGGTGATCTCATCATGCTGAGGG - Intergenic
1061703679 9:132435757-132435779 GGGTGCCCTCATGGTATTGAAGG - Intronic
1062049443 9:134439477-134439499 GTGTGCTTCCAGGGTGCGGAGGG - Intronic
1062703599 9:137921526-137921548 CTGTGCGGTCACGGTGCTGATGG - Intronic
1203519454 Un_GL000213v1:32745-32767 ATGTGCTATCATGGTGGTAAAGG + Intergenic
1186137308 X:6533582-6533604 GTGTTCTCTGATGGTGGGGAGGG - Intergenic
1186267136 X:7844157-7844179 GTGTTCTCTGATGGTGGGGAGGG + Intergenic
1186298009 X:8169908-8169930 GTGTTCTCTGATGGTGGGGAGGG - Intergenic
1186324841 X:8466524-8466546 GTGTTCTCTGATGGTGGGGAGGG + Intergenic
1187376782 X:18762704-18762726 GTAAGCTGTCATGATGCTGATGG + Intronic
1187402555 X:18974678-18974700 GTGAGCTCACATGGTGGTGGTGG + Intronic
1188069771 X:25704646-25704668 CTGTTCACTCATGGAGCTGATGG + Intergenic
1188336016 X:28933893-28933915 GTAAACTGTCATGGTGCTGATGG + Intronic
1189378103 X:40481430-40481452 GGCTGGTCTCATGGTTCTGAAGG - Intergenic
1191004833 X:55700268-55700290 GTAAACTCTCATGGTGCTGGTGG + Intergenic
1192730825 X:73801110-73801132 GTAAACTGTCATGGTGCTGATGG + Intergenic
1194803112 X:98295613-98295635 GTAAACTGTCATGGTGCTGATGG - Intergenic
1198010326 X:132545935-132545957 GTGTCCTCACATGGTGAAGAGGG - Intergenic
1199470338 X:148188176-148188198 GTTTGCCCTCATGGGGATGAAGG - Intergenic
1199482101 X:148309044-148309066 GTGTTCTCTCATTTTCCTGAGGG - Intergenic
1199545330 X:149002734-149002756 GTAAACTATCATGGTGCTGATGG - Intergenic
1201438685 Y:13985736-13985758 GTGTTCTCTGATGGTGAGGAGGG - Intergenic
1201445888 Y:14056972-14056994 GTGTTCTCTGATGGTGAGGAGGG + Intergenic