ID: 936271418

View in Genome Browser
Species Human (GRCh38)
Location 2:111052294-111052316
Sequence GTGTGCTCTCATGGTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 283}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936271418_936271427 19 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271427 2:111052336-111052358 TGGAACCATGAGGGGTACTGTGG 0: 1
1: 0
2: 2
3: 7
4: 112
936271418_936271423 -1 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271423 2:111052316-111052338 CACGGGAGGTGTGACTGCAGTGG 0: 1
1: 0
2: 2
3: 18
4: 179
936271418_936271426 11 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271426 2:111052328-111052350 GACTGCAGTGGAACCATGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 183
936271418_936271425 10 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271425 2:111052327-111052349 TGACTGCAGTGGAACCATGAGGG 0: 1
1: 0
2: 0
3: 60
4: 1130
936271418_936271428 22 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271428 2:111052339-111052361 AACCATGAGGGGTACTGTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 123
936271418_936271424 9 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271424 2:111052326-111052348 GTGACTGCAGTGGAACCATGAGG 0: 1
1: 0
2: 1
3: 22
4: 216
936271418_936271430 26 Left 936271418 2:111052294-111052316 CCTTCAGCACCATGAGAGCACAC 0: 1
1: 0
2: 1
3: 18
4: 283
Right 936271430 2:111052343-111052365 ATGAGGGGTACTGTGGTGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936271418 Original CRISPR GTGTGCTCTCATGGTGCTGA AGG (reversed) Intronic