ID: 936271643

View in Genome Browser
Species Human (GRCh38)
Location 2:111053781-111053803
Sequence CCCCAGCCAGGGGCCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936271637_936271643 -3 Left 936271637 2:111053761-111053783 CCAATTTGGGTGGGAGATAGCCC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 936271643 2:111053781-111053803 CCCCAGCCAGGGGCCTCCATGGG 0: 1
1: 0
2: 4
3: 34
4: 275
936271636_936271643 0 Left 936271636 2:111053758-111053780 CCTCCAATTTGGGTGGGAGATAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 936271643 2:111053781-111053803 CCCCAGCCAGGGGCCTCCATGGG 0: 1
1: 0
2: 4
3: 34
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936271643 Original CRISPR CCCCAGCCAGGGGCCTCCAT GGG Intronic
900179537 1:1305163-1305185 CCCCAGCCAGGGACCTTGAAGGG + Intronic
900379877 1:2378443-2378465 GCCCAACCGGGGGCCTCCACGGG - Intronic
900568269 1:3345972-3345994 CCCCATCCAGGGGCCTGCGGAGG + Intronic
900626229 1:3609940-3609962 GACCAGCCAGGGGCTTCCAGGGG - Intronic
901210045 1:7519528-7519550 CCTCAGCCAGGGACCTTCCTTGG + Intronic
901572619 1:10173953-10173975 CCCAAGCCAGGTGCCACCAGAGG - Intronic
902875592 1:19338975-19338997 CCCCACCCCGCGGCCTCCGTGGG + Exonic
905146148 1:35888278-35888300 ACCCAGCCAAGGGCTTCCAGGGG - Intronic
906035182 1:42746450-42746472 CCACCCCCAGGGGCCTCCACAGG - Exonic
906747567 1:48232410-48232432 CCCCAGCACGGAGCCTCCCTTGG - Exonic
907299410 1:53477233-53477255 CACCAGCCAAGGGGCTCCAAGGG - Intergenic
907322696 1:53615450-53615472 CCCCAGCCTGGAGTCTCCCTTGG - Intronic
907576935 1:55534993-55535015 CCCCAGCCAGTGCCCCACATGGG - Intergenic
909611835 1:77559089-77559111 CCTATGCCAGGGGCCTCCATTGG - Exonic
910859509 1:91730176-91730198 CCCCAACTAGGGGCCTCTTTTGG + Intronic
914899647 1:151704965-151704987 CTGCAGCCAGGGCCCTCGATTGG - Intronic
921709913 1:218363717-218363739 CTCCAGAGAGTGGCCTCCATGGG - Intronic
923877254 1:238062718-238062740 CCACAGCTAGGGGGATCCATAGG - Intergenic
924052541 1:240092830-240092852 CCTCAGCCCGGGGCCTTCCTGGG + Exonic
924383541 1:243483646-243483668 CCCCAGCCAGGAGGCTCCGCAGG + Intronic
924520505 1:244802168-244802190 CCCCAGCCTGGGCCCTGCAGAGG - Intergenic
1063459219 10:6204525-6204547 CCCCACCCAGGGCACACCATGGG - Intronic
1067431216 10:46247343-46247365 CCACAGCTATGGGCCTCCCTGGG + Intergenic
1067442197 10:46314884-46314906 CCACAGCTATGGGCCTCCCTGGG - Intronic
1069774221 10:70917511-70917533 CCACAGTCAGCGGCCTCCATGGG - Intergenic
1069822748 10:71237696-71237718 CTCCAGCCTGTGGCCTCTATAGG + Intronic
1069993428 10:72328761-72328783 CCACAACCTGGGGTCTCCATGGG - Intergenic
1070820671 10:79352263-79352285 TCCCAGGCAGGTGCCTCCAGGGG + Intronic
1070932662 10:80272233-80272255 GCTCAGGCAGGGGCCTCCATGGG - Exonic
1075938281 10:126363470-126363492 CCCCAGACAAGGGACTCCTTGGG - Intronic
1076217906 10:128710772-128710794 CCCCAGCCTGGGACCTCAAGTGG - Intergenic
1076343776 10:129766882-129766904 CCCCAACCGGTGGCCTTCATGGG - Exonic
1076402699 10:130194221-130194243 CACCAGCCTGGGACCTCCAGGGG - Intergenic
1076818160 10:132924724-132924746 CGCCAGCCAGGGGCTTCCGCAGG + Exonic
1076869535 10:133186548-133186570 CCCCAGCCAGGGGCCAGCAGAGG + Exonic
1077419476 11:2443923-2443945 CCCCACCCAGGGGAATCCACGGG + Intergenic
1077556410 11:3228149-3228171 CCCCACCCCGGGGCTTCCCTGGG - Exonic
1078402941 11:11044260-11044282 CCCAAGGCAGTGGCCTCCGTGGG + Intergenic
1079332631 11:19546367-19546389 CCCCAGCATGGGGCCTCCATTGG - Intronic
1079345014 11:19644407-19644429 CACCGGCCTGGGGCCACCATAGG - Intronic
1080285708 11:30608677-30608699 CTCCAGCCAGTGGCTCCCATTGG - Intergenic
1082665488 11:55971061-55971083 CCCCAGCCAGGTACCTCCTGGGG + Intergenic
1083486178 11:62984283-62984305 CCCCATCCAGGGGCCAAGATGGG - Intronic
1084692673 11:70736131-70736153 ACCCAGCCAGGGGCCTTGACTGG - Intronic
1084715285 11:70869745-70869767 CCCCAGACAGGGGGCTCGACGGG + Intronic
1087583226 11:100085537-100085559 CACCAGACAGGTGCCTCCTTGGG - Intronic
1088409880 11:109522597-109522619 GCCCAGCCAGGAGCCTACATGGG + Intergenic
1089377465 11:118004802-118004824 GCCCAGCCAGGAGCCTCACTGGG + Intergenic
1089596936 11:119586387-119586409 CCCCAGCCCGGGGCTACCCTTGG + Intergenic
1089853140 11:121517523-121517545 CCACAGCCAGGGGCTTTCAATGG - Intronic
1090258670 11:125303436-125303458 CCCGAGCCTGGGGCCTGCCTGGG - Intronic
1090543505 11:127735438-127735460 CCCAAGCCAGGAGCCTTTATAGG - Intergenic
1090977027 11:131687491-131687513 CCCAGGCTAGGGGCCTTCATGGG + Intronic
1091738714 12:2944542-2944564 CCCCAGCCAGGGGCATGCCAAGG + Intergenic
1091985683 12:4909105-4909127 CCCCAGCCTAGTGCCTCCACAGG - Intergenic
1093296750 12:17400848-17400870 CCCCAGCCAGCTGCCTCCTAAGG + Intergenic
1096196831 12:49654016-49654038 CCCCAGTCAGGCAGCTCCATGGG - Intronic
1096580648 12:52582672-52582694 GCACAGCCAGGGGGCTCCATAGG - Intergenic
1097192746 12:57227179-57227201 CTCCAGCCAGGGGCCCCAAGGGG - Intergenic
1100596858 12:96079296-96079318 CCTCAGCCTGGGGCCCCCTTCGG + Intergenic
1102580169 12:113881382-113881404 CCCCAGCCGTGGGCCTCCTCTGG - Intronic
1104035052 12:125092162-125092184 CCCCAGCCAGGGCCCTCTCCTGG + Intronic
1104384933 12:128342509-128342531 CCTCGGCCAGGGGCATCCACTGG - Intronic
1104714358 12:131006565-131006587 CTCCAGACAGGCCCCTCCATAGG + Intronic
1105281054 13:18962816-18962838 CAGCAGCCTGGGGCCTCCCTGGG + Intergenic
1105290256 13:19048828-19048850 CAGCAGCCTGGGGCCTCCCTGGG + Intergenic
1105541540 13:21320871-21320893 CCCCAGCCAGAGGCCCCCACGGG + Intergenic
1105544718 13:21342928-21342950 CCCCTGACAGGGGCCTCTGTGGG - Intergenic
1111509421 13:89241868-89241890 CCCCCTCCAGGAACCTCCATGGG + Intergenic
1112483564 13:99799895-99799917 ACCCACCCAGGGGCCTGCAGCGG + Intronic
1113272009 13:108684619-108684641 CCCCAGCCAGAAGCCACCAGGGG - Intronic
1113721685 13:112562305-112562327 CACCAGCCAGGGGCCACTAGGGG + Intronic
1113946935 13:114049755-114049777 CCCCTGCCAGGGGCCTCCAAGGG - Intronic
1113964513 13:114145104-114145126 CCCCAGCCAGGGCTCGCCTTAGG + Intergenic
1114627854 14:24141094-24141116 CCTCAACCAGGTGCCTCCGTTGG - Exonic
1114650916 14:24284196-24284218 CCACAGCCAGGCACCTCCCTAGG - Intergenic
1115392114 14:32865855-32865877 CCTTAGGCAGGGGCCACCATTGG + Intergenic
1119198689 14:72736964-72736986 CCCAAGCCAGCCGCCTCCCTGGG + Intronic
1119480514 14:74955255-74955277 CCCGAGCCAGGGGGCTCCGAGGG + Exonic
1119674994 14:76546959-76546981 CTCCACCCAGGAGCCTCCACAGG + Intergenic
1119719940 14:76883776-76883798 TCCCTGCCAAGGCCCTCCATGGG + Intergenic
1121316698 14:92965134-92965156 CCTGAGCCAGGGAGCTCCATGGG - Intronic
1121908726 14:97770015-97770037 GAGCAGCCAGGGGCCTCCCTTGG + Intergenic
1122157148 14:99756435-99756457 CCCCAGACAGAGGCCTCCCGCGG - Intronic
1122412304 14:101531859-101531881 ACCCAGCCAGGGGGCTCTGTGGG - Intergenic
1124234070 15:27971520-27971542 CCCCAGCCACAAGCCTCCCTTGG - Intronic
1125294807 15:38191153-38191175 CCCCAGCCTGTGACCTTCATGGG + Intergenic
1125809360 15:42524376-42524398 CCCCAGCCATGGACCACTATTGG + Intronic
1126112720 15:45185142-45185164 CCCCAGCCACTGGGCTCCAGAGG + Intronic
1127761009 15:62139152-62139174 CCCCAGCCAAGGACCTACAGTGG - Intergenic
1129667435 15:77587450-77587472 CCCCCGCCAGGACCCTCCTTTGG - Intergenic
1129707872 15:77804998-77805020 ACCCCTCCAGGGGCCTCCCTCGG + Intronic
1131114074 15:89783600-89783622 CACCAGCCAGGAGGCTCCCTGGG - Intergenic
1131149242 15:90036648-90036670 CCCCAGCTCGAGGCCTGCATGGG - Intronic
1132028322 15:98421093-98421115 CCCCAGCCTGGGGCCTTCTTGGG - Intergenic
1132607706 16:800422-800444 CCCCAGCCACGGGACTCGGTGGG + Intronic
1132670139 16:1099126-1099148 CCCCACCCAGGAGCCTCCCGTGG + Intergenic
1132683943 16:1154429-1154451 CCCCCGCGAGGGGCCTGCCTCGG - Intronic
1132840846 16:1977914-1977936 CCCCAGCCAGCGGCCCTCAGTGG + Intronic
1132905487 16:2280585-2280607 CCTCTGCCCGGGGCCTGCATGGG - Intronic
1133325112 16:4937325-4937347 CCCCAGCCGGGGGACTCCGGAGG + Intronic
1135096599 16:19569600-19569622 CCCCAGCCATGGTCGTCCAGTGG + Intronic
1136010840 16:27362709-27362731 CCCCAGGGAGGTGCCTCCTTGGG - Exonic
1137586086 16:49664650-49664672 CCCCACCCAGGGGCCTCCCAGGG - Intronic
1137664964 16:50244783-50244805 ACCCGGCCAGGGCCCTCCACGGG + Intergenic
1139379310 16:66520487-66520509 CCCCAGCCAGGGGCCCAATTTGG + Intronic
1140862365 16:79029161-79029183 TCCCAGCCTGGGGCCTCCAGAGG - Intronic
1141142885 16:81508798-81508820 CCCCATCCTGGGGCCTACGTGGG - Intronic
1141438252 16:84013159-84013181 CCTGAGCCAGGGGCACCCATGGG - Intronic
1142163144 16:88569860-88569882 CCACAGCCCGGGGCGTCCAGGGG - Intergenic
1142251829 16:88995508-88995530 CCCCATCCAGGAGCCCCCATGGG - Intergenic
1142518682 17:490141-490163 CCCCAGCCTGCGGCCTCCCGGGG - Intergenic
1144468077 17:15512877-15512899 CCCAAGCAGGGGGACTCCATGGG - Intronic
1144845763 17:18218039-18218061 ACCCAGACCGGGGCCTCCTTTGG + Intergenic
1145123195 17:20278972-20278994 CCCCAGCTGAGGGCCTCCATGGG + Intronic
1145915435 17:28571262-28571284 CCCCAACCACCGGCCTCCAGGGG + Intronic
1145979579 17:29003839-29003861 CCACTGGCAGGTGCCTCCATGGG + Intronic
1147188441 17:38725425-38725447 CCCAGGCCAGAGGCTTCCATTGG + Intronic
1147970817 17:44218641-44218663 CTCCAGCCTGGGGCCTCCCCGGG - Intronic
1148286756 17:46400195-46400217 CCCCATCTAGTGGCCTCCAGTGG - Intergenic
1148308922 17:46617785-46617807 CCCCATCTAGTGGCCTCCAGTGG - Intronic
1149194491 17:54102887-54102909 TCCCAGCCATGGGGCTCCCTTGG - Intergenic
1149437176 17:56643105-56643127 CCTTAGCCAGGGGCATCGATAGG + Intergenic
1149646411 17:58244750-58244772 CCCCAGCCAGGCCACTCCAGTGG + Intronic
1151337763 17:73450155-73450177 CCCCAGCCAGAGCCCTGCACGGG - Intronic
1151419095 17:73985679-73985701 ACCCAGCCAGGGACCTTCCTGGG + Intergenic
1151884136 17:76913502-76913524 CGTCACCCAGTGGCCTCCATGGG - Intronic
1152037335 17:77881353-77881375 CCCTGGGCAGGGGCCACCATGGG - Intergenic
1152368427 17:79870549-79870571 CTCCAGCCAGGGGCCAACCTGGG + Intergenic
1152766782 17:82145741-82145763 CCCCACTCAGGGGCCTGCAGGGG - Intronic
1152926772 17:83090988-83091010 CCACACCCCGGGGCCCCCATAGG + Intronic
1153219237 18:2847413-2847435 CGGCAGCCGGGGGCCTCCCTTGG + Intronic
1153998155 18:10460263-10460285 CCCAGGCCAAGGGCCTCCTTTGG + Intronic
1154218110 18:12430172-12430194 CCCAAGCCAGGGGTGGCCATGGG + Intronic
1154309981 18:13259891-13259913 TCCCCTCCTGGGGCCTCCATTGG - Intronic
1156485729 18:37464449-37464471 CCCCAGCCAGGGGCCTAGAAAGG - Intronic
1157275848 18:46310809-46310831 CCCCATTCAGGGGCCTGCAGTGG - Intergenic
1159770482 18:72542141-72542163 CCCCGGCCGGGCGCCTGCATCGG + Exonic
1159905197 18:74083469-74083491 CACCAGTCAGAGGCCTCCCTTGG - Intronic
1160846739 19:1169337-1169359 CCCCAGGCTGAGGCCTCCGTGGG + Intronic
1160891024 19:1378878-1378900 CAGCAGCCAGGGGCCTCACTGGG + Intergenic
1160989606 19:1855189-1855211 CCCCACCCAGGGGCATGCAGGGG + Intronic
1161089489 19:2352882-2352904 CCCCTGCCAGGGTCCTCCTCTGG + Intronic
1161219487 19:3111799-3111821 CTCCTGCCAGTGGCCTCCCTGGG + Intronic
1162140181 19:8580734-8580756 CCCCAGCCAGGGCCCTGCAGGGG + Exonic
1163577106 19:18117506-18117528 CCCCAGGCTGGGGGCTCCTTAGG - Intronic
1163767922 19:19173559-19173581 CCCCAGCCTGGGGGTTCCTTGGG + Intronic
1164694791 19:30235172-30235194 CCCCAGGGAAGGGCCTCCCTTGG + Intronic
1165396212 19:35565019-35565041 CCTCAGGTAGGGACCTCCATGGG + Intergenic
1166102082 19:40576932-40576954 CCCCAGTCGGGGGCCTCCCGGGG + Exonic
1166230885 19:41425426-41425448 CCCCAGCCAGGGGCCTGGGCAGG - Exonic
1166384185 19:42370964-42370986 CCCCAGCCTGGGCGCTCCCTGGG - Intronic
1167853719 19:52221211-52221233 CCCAAGCCAGGTGTCTCCCTTGG - Intronic
1168306791 19:55440384-55440406 CCCCACCCAGGGGGGTCCACAGG + Intronic
1168643871 19:58047517-58047539 CCCTAGCCATGGGACTCCCTTGG + Intronic
925004574 2:431263-431285 CCCCAGCCAGCGTCATGCATGGG - Intergenic
925176013 2:1784409-1784431 CCCAGGCCAGCAGCCTCCATCGG + Intergenic
926109602 2:10173525-10173547 ATCCAGCCACGGGCCTGCATTGG - Intronic
926227774 2:10980699-10980721 CACCAGCCAGGGGCCTGCTCTGG + Intergenic
926793679 2:16600985-16601007 CCCCAGGCAGGGGCCTCCTAGGG - Intronic
928016703 2:27664208-27664230 CCCCTACCAAGAGCCTCCATGGG + Exonic
928201686 2:29251313-29251335 CCTCCTCCAGGGGCCTCCCTGGG + Intronic
929788243 2:45007000-45007022 TCCCAGCCAGGGGTCTCCCTCGG - Intronic
932202606 2:69845155-69845177 CCCCAGCCTGAAGCCTGCATGGG - Intronic
936088483 2:109486052-109486074 CCCCAGCCAGGGACACACATGGG - Intronic
936271643 2:111053781-111053803 CCCCAGCCAGGGGCCTCCATGGG + Intronic
936677035 2:114727542-114727564 CCCAAACCACTGGCCTCCATTGG + Intronic
941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG + Intergenic
942189494 2:173456293-173456315 CCCCAGCATGGGGTCCCCATGGG - Intergenic
944873071 2:203933594-203933616 CCCCACCCAGGATCCTCCACTGG - Intergenic
945062847 2:205924024-205924046 TCCCAGCATGGGGGCTCCATAGG - Intergenic
947388829 2:229619496-229619518 CTCCATCCAGTGGCCTCCAGTGG - Intronic
947590154 2:231380799-231380821 CCCGAGCCCTGGGCATCCATCGG - Intergenic
947625161 2:231614327-231614349 CCCCACCCAGGCGCCCCGATGGG + Intergenic
948093783 2:235317252-235317274 TCCCAGCCATAGGCATCCATGGG - Intergenic
948460756 2:238128900-238128922 CCCCTGCCGGGGGCCTACCTGGG - Exonic
1168793550 20:596110-596132 CCCCACCCAGGGGCCTCCCCAGG - Intergenic
1169245287 20:4019967-4019989 CCCCAGCAAGAGGTCCCCATGGG - Intergenic
1170812466 20:19685206-19685228 CCCCAGACAGGGGCGTGAATGGG + Exonic
1171164207 20:22956345-22956367 GCCCAGCCAGTGTCCTCCATGGG + Intergenic
1171238699 20:23548076-23548098 CCCTAGCCAGCAGCCTCCAGGGG + Intergenic
1172126435 20:32627540-32627562 CCCCAGCCCTGGGCCACCCTTGG + Intergenic
1172613537 20:36268320-36268342 CCCCAGGGCGGGGGCTCCATTGG + Intronic
1175873308 20:62218415-62218437 CCCCACCCAGGTGCCTCCCATGG + Intronic
1175953091 20:62593820-62593842 CCCCAACCTGGGGCATCCTTTGG + Intergenic
1177319865 21:19508017-19508039 CCCAAGACAGGTGCCTCAATAGG - Intergenic
1178927409 21:36787385-36787407 AACCAGCCAAGTGCCTCCATGGG - Intronic
1179180210 21:39038089-39038111 CCTCAGCCAGGGGCCTGGAGGGG + Intergenic
1179331029 21:40401782-40401804 CCCAAGCCAGGGCCTTCCAAAGG + Intronic
1179828531 21:43981816-43981838 CCCCTGCCAGGGGCCTTGGTGGG + Intronic
1180959149 22:19754872-19754894 ACCCAGCCTGGGGTCTCAATGGG - Intergenic
1180975791 22:19847442-19847464 CCCCAGCCAAGGCACTGCATGGG + Exonic
1181031073 22:20149124-20149146 CCCCACCCAGGGCCCTGCTTGGG - Intronic
1181437477 22:22919033-22919055 CCCCACCAAGGGGCCTCTGTGGG + Intergenic
1181584518 22:23845765-23845787 TCTCAGCCAGGAGCCTTCATGGG + Intergenic
1181600999 22:23951862-23951884 CCCCAGCCAGTTCCATCCATAGG - Intergenic
1181607510 22:23989464-23989486 CCCCAGCCAGTTCCATCCATAGG + Intergenic
1182351483 22:29702473-29702495 CCCCAGCAGGGGCCCTCCTTGGG + Intergenic
1182428699 22:30288146-30288168 CGCCAGCCTGGGCCCTCCCTGGG - Intronic
1183380400 22:37487829-37487851 CCCCAGCCAGGCCCCTTCACAGG + Intergenic
1183672890 22:39283438-39283460 AGCCAGCCAGGGGACTCCAGAGG + Intergenic
1184717644 22:46290985-46291007 CACCAGCCAAGGGCCTCCTGTGG - Intronic
1184784096 22:46663493-46663515 CCCCTGCCAGGTGCTGCCATAGG + Intronic
1184955196 22:47881250-47881272 CCTCAGCCCGGGGCCTCCTGGGG + Intergenic
1185245741 22:49771824-49771846 CCCCCGACAGCGGCCTCCCTGGG + Intergenic
1185273228 22:49938092-49938114 CGCCAGCCAGTGGCCTTCCTGGG + Intergenic
950377410 3:12582989-12583011 CTCCAGCCAGGGCCCTCTAGGGG + Exonic
950645333 3:14373606-14373628 CCCCAGCCATGGCCCTCCAAGGG - Intergenic
953374490 3:42417248-42417270 CCCCAGCCAGTGGCAGCCCTGGG + Intergenic
953559188 3:43971648-43971670 GCCCAGCCAGGCCCCACCATTGG - Intergenic
953566318 3:44034755-44034777 CCCCACCCAGGAGCCGCCATGGG - Intergenic
953877222 3:46673297-46673319 CCCAAGCCAGGGGCCCCCAGAGG - Intronic
954288879 3:49638499-49638521 CCTCAGCCAGTGTCCTCCTTAGG + Intronic
961446115 3:126982632-126982654 CACCAGCCTGGGGCCTGCAGGGG + Intergenic
965519321 3:169657701-169657723 CCCCAGCCAGGGCACTTCAAAGG + Intronic
967499973 3:190186258-190186280 CCGCAGCAAGGTGCCTTCATAGG + Intergenic
968424928 4:516982-517004 CAGCAGACAGGGTCCTCCATGGG + Intronic
968447416 4:658662-658684 CCCCAGCCAGGGGCCTTGCATGG + Intronic
968576243 4:1367568-1367590 TCCCAGCCTGGGCCCTCCCTGGG - Intronic
968759797 4:2436836-2436858 GCCCAGCCAGGGCCCCCCACCGG + Intronic
968922341 4:3528847-3528869 GGCCAGCCAGTGGCCTCCATGGG - Intronic
968962744 4:3753562-3753584 GCCCAGCCAGGAGCCCCCAGGGG - Intergenic
969217611 4:5734823-5734845 CCCCATCCAGGGACCTCCATGGG - Intronic
969437982 4:7199540-7199562 CCCCAGCCAGGAAACACCATGGG - Intronic
969442285 4:7224519-7224541 CCCCAGCCATGGACCACCATGGG - Intronic
969522807 4:7688691-7688713 CCCAAGTCAGGGAACTCCATAGG - Intronic
969898020 4:10323063-10323085 CCCCAGCCTGGGAGCTCCCTAGG - Intergenic
971191611 4:24433964-24433986 CCCCAGCTAGGGTCTTCCGTGGG - Intergenic
971372474 4:26029668-26029690 ACACAGCCAGGGACCTTCATGGG - Intergenic
972515669 4:39808590-39808612 CCCCAGCTAGGATCCTCCCTGGG + Intergenic
978795644 4:112705591-112705613 CAACAGCCAGGGGCCTCCCGAGG + Intergenic
979485143 4:121262463-121262485 CCCCAACCAGGGCTTTCCATTGG + Intergenic
979670021 4:123352005-123352027 CCCCGGCCAGCGACCTCCCTTGG - Intergenic
982513738 4:156318083-156318105 TCCCAGCAACAGGCCTCCATTGG - Intergenic
985343556 4:188976907-188976929 CCCCAGCAAGAGGCCTCCTAAGG + Intergenic
985718048 5:1473655-1473677 ACCCAGCCTGGGGTCTCCAAGGG - Intronic
986083981 5:4424454-4424476 CCCCAGCCGAGGGCAGCCATGGG - Intergenic
987072881 5:14354399-14354421 CTACAGCCAGAGGCCTCCATTGG + Intronic
987293081 5:16526157-16526179 CCACAGCAATGGCCCTCCATGGG - Intronic
991628959 5:68634745-68634767 CTACAGCCAGGGGCCTGCCTGGG + Intergenic
992400239 5:76404290-76404312 ACCCAGCCAGGGGCTGCCCTCGG + Intronic
997235780 5:132271308-132271330 ACCCAGCCAGAGGCCTCCCGCGG + Exonic
997692333 5:135835183-135835205 GCGCCGCCAGGAGCCTCCATTGG - Intronic
998007398 5:138666076-138666098 CTCCTGCCAGTGGCTTCCATTGG + Intronic
999303204 5:150503741-150503763 CCCTAGCCAAGGGTCTTCATTGG + Intronic
1002329960 5:178434540-178434562 CCCCAGCCTGGGGCCTTCCCTGG + Intronic
1004505820 6:16245961-16245983 TCCCACCCAGTGTCCTCCATTGG + Intronic
1006193416 6:32223031-32223053 GCTCAGGCAGGTGCCTCCATTGG + Exonic
1006744315 6:36330651-36330673 TCTCCGCCAGGGGCCTCCTTGGG + Exonic
1006840702 6:37026387-37026409 CTCCAGCCCTGGGTCTCCATGGG - Intronic
1007730276 6:43941298-43941320 CACCAGCCAAGGGCCTCTCTGGG + Intergenic
1017929366 6:158939027-158939049 CCACAGCCGGGGGCCCCCAAGGG - Intergenic
1018699121 6:166412942-166412964 CCGGAGCCCGGGGCCTCCATGGG + Intronic
1018931242 6:168241752-168241774 CCCCAGCCAGCTGCCTCCATAGG - Intergenic
1019322392 7:421632-421654 TCCCAGCCAGAGGCCGCCAGCGG - Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019605714 7:1909230-1909252 CCCCAGCCCTGGGCCTCCACTGG - Intronic
1022505212 7:30905465-30905487 CTCCAGCCAGGTGTCTCCACAGG - Intergenic
1023623632 7:42095990-42096012 CACCAGTCAGGGGCCTCCAAGGG + Intronic
1023680142 7:42677123-42677145 CCTCAGCCTGGGGCCTTCAACGG + Intergenic
1023806437 7:43876218-43876240 CCCAACCCAAGGGCCTCCAGTGG - Exonic
1024331563 7:48160447-48160469 CTCCAGCCTGGAGCCCCCATTGG - Intergenic
1024621141 7:51158811-51158833 CCTGAGCCAGGGGTGTCCATAGG + Intronic
1026911740 7:74095112-74095134 CCACAGCCTGGGGCCTGCATGGG - Intronic
1027161182 7:75803547-75803569 CTCCAGCCAGGGGCCTTGAGAGG - Intergenic
1029713808 7:102314735-102314757 CCCCAGCCATGGCCACCCATGGG + Intronic
1030689454 7:112517540-112517562 CACCAGTCAGGTGCATCCATGGG - Intergenic
1031636895 7:124112358-124112380 TCCCAGCCAGAGTCCTTCATGGG - Intergenic
1031987367 7:128171826-128171848 CACCAGCCATGGCCCTTCATGGG + Intergenic
1032516086 7:132507431-132507453 CCCCAGCCTGTAGCCCCCATGGG - Intronic
1033548480 7:142423964-142423986 CCCCAGCCACGGCCTCCCATGGG + Intergenic
1034982574 7:155488402-155488424 CCTCAGCTGGGGGCCTCCAGGGG - Intronic
1034984294 7:155497668-155497690 CCCCAGCCTGGGCCCTGCATAGG - Intronic
1035072669 7:156156803-156156825 CCCCAGCCAGGAGCCCACCTGGG - Intergenic
1035443093 7:158920268-158920290 CCACAGCGTGTGGCCTCCATCGG + Intronic
1038176426 8:25185034-25185056 CCCCGGCCAGGGTCCTCCGCCGG - Intronic
1046026807 8:108734245-108734267 CCCCAGCCTGTGGACTCCAGTGG + Intronic
1049010032 8:139881160-139881182 CTCCAGCCAGAGGCCACCAGAGG - Intronic
1049476187 8:142797956-142797978 CCGCAGGCAGGGGCCTCCCCAGG - Intergenic
1049594495 8:143477152-143477174 CAGCAGCCGGGGGCCTCCAAGGG + Intronic
1049688698 8:143949540-143949562 GCCCAGCCTGGGGCCTAGATAGG - Intronic
1053520134 9:38769080-38769102 CCACAGCCTGGGGCCTCCCCAGG + Intergenic
1053618681 9:39794525-39794547 CCACAGCCAGAGGCCTCCCATGG + Intergenic
1053876858 9:42553887-42553909 CCACAGCCAGAGGCCTCCCATGG + Intergenic
1054234840 9:62547835-62547857 CCACAGCCAGAGGCCTCCCATGG - Intergenic
1054265474 9:62912904-62912926 CCACAGCCAGAGGCCTCCCATGG - Intergenic
1054820092 9:69513674-69513696 CCCCAGCAAGGGGACAGCATTGG - Intronic
1055564062 9:77550115-77550137 CACCAGCCAGGGGTTTCCATTGG + Intronic
1056538569 9:87552117-87552139 CCCCAGGCAGGGCCCTGCCTGGG - Intronic
1056823448 9:89860519-89860541 CCCCAGCCTGGAGCTTCCAGGGG + Intergenic
1057271786 9:93655741-93655763 CAGCAGCCTGGGGCCTCCCTGGG - Intronic
1058678612 9:107422489-107422511 CCCCTTCCAGGGACCTCCCTAGG - Intergenic
1059460417 9:114426077-114426099 CCCACACCAGGGCCCTCCATTGG - Intronic
1060721641 9:125983543-125983565 CCCAAGCCAGGAACCTCCTTTGG + Intergenic
1061789100 9:133049182-133049204 CCACAGCCTGAGGCCACCATGGG + Intronic
1062574148 9:137198796-137198818 CCCAAGTCAGGGGGCTCCACTGG + Intronic
1062730153 9:138104107-138104129 CCCCACCCTGAGGCCTCCCTTGG - Intronic
1062730593 9:138106118-138106140 CCACAGCCAGCGCCCTCCCTGGG + Intronic
1186352151 X:8750934-8750956 CTCCACCCAGGGGCCTCCTGGGG - Intergenic
1187933052 X:24311514-24311536 CCCGAGCCAGGGGCCTGCACAGG + Intergenic
1187939161 X:24364645-24364667 CCCGAGCCAGGGGCCTGCACAGG - Intergenic
1188001970 X:24991258-24991280 CCTCAGCAAGGGGGCTGCATGGG + Intronic
1191215833 X:57931589-57931611 CCCTTGCCAGGTGCCCCCATCGG - Intergenic
1195323950 X:103743132-103743154 CCGCAGCCAGGAGCCTCCAGAGG + Intergenic
1199615627 X:149652710-149652732 CCCAAGCCTGGGGCTTCCCTGGG + Intergenic
1199627076 X:149750630-149750652 CCCCAACCTGGGGCTTCCCTGGG - Intergenic
1199628360 X:149760198-149760220 CCCCTACCTGGGGCCTCCAGGGG - Intergenic
1200089564 X:153627974-153627996 CGGCAGCCAGGGGCCTCAAGGGG + Intergenic
1200133294 X:153862937-153862959 CCCCAGCCAGGCTCCTGCAGGGG - Intronic
1200229740 X:154437879-154437901 ACCCAGCCTGAGGTCTCCATGGG - Intronic
1200269946 X:154673442-154673464 CTCCAGCATGGTGCCTCCATTGG + Intergenic
1202243713 Y:22794976-22794998 CCCCAGAGAGGGGCCCCCACAGG - Intergenic
1202396700 Y:24428726-24428748 CCCCAGAGAGGGGCCCCCACAGG - Intergenic
1202474083 Y:25241366-25241388 CCCCAGAGAGGGGCCCCCACAGG + Intergenic