ID: 936271643

View in Genome Browser
Species Human (GRCh38)
Location 2:111053781-111053803
Sequence CCCCAGCCAGGGGCCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936271636_936271643 0 Left 936271636 2:111053758-111053780 CCTCCAATTTGGGTGGGAGATAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 936271643 2:111053781-111053803 CCCCAGCCAGGGGCCTCCATGGG 0: 1
1: 0
2: 4
3: 34
4: 275
936271637_936271643 -3 Left 936271637 2:111053761-111053783 CCAATTTGGGTGGGAGATAGCCC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 936271643 2:111053781-111053803 CCCCAGCCAGGGGCCTCCATGGG 0: 1
1: 0
2: 4
3: 34
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936271643 Original CRISPR CCCCAGCCAGGGGCCTCCAT GGG Intronic