ID: 936275600

View in Genome Browser
Species Human (GRCh38)
Location 2:111094167-111094189
Sequence GAAAACCTGGAGAAGTCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936275600 Original CRISPR GAAAACCTGGAGAAGTCGTC AGG Intronic
902243202 1:15102262-15102284 GAAAACCCAGAGAAGTCTTCAGG + Intronic
906194792 1:43923102-43923124 GAAAAATTGGAAAAGTTGTCTGG + Intronic
908734457 1:67261707-67261729 GCAAACCTGATGAAGACGTCTGG + Intergenic
911206347 1:95094903-95094925 GAAAGCCTGAAGAATTCCTCAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
922538697 1:226402795-226402817 GCAAGCCTGGAGCAGTTGTCTGG - Intronic
1063214601 10:3912879-3912901 GAAAACCTGGGGTAGGCGTGGGG + Intergenic
1074963625 10:118469869-118469891 GAAAACCTGGAGACGTTGTTAGG - Intergenic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1083170516 11:60921724-60921746 GCCAACCTGGAGAAGTGGTGAGG - Intronic
1083421518 11:62556014-62556036 GAGAAACTGGAGAAGGGGTCGGG - Intronic
1083993935 11:66262960-66262982 GAAGACCTGGAGAAGACGTCAGG + Exonic
1088982636 11:114877205-114877227 GAAAACCTGGGCAAGTATTCGGG - Intergenic
1090231023 11:125103748-125103770 GAAAACCAGGAGAGGTAGTGTGG - Intronic
1090856388 11:130612503-130612525 GAAATCCTGGGGAATGCGTCTGG + Intergenic
1092987095 12:13856289-13856311 GAAATCCTGGAGAGGTGGCCTGG + Intronic
1112893764 13:104271626-104271648 AAAAACCTGGAGAATTCATGAGG - Intergenic
1114776263 14:25485565-25485587 CAAAGCCTGGACAAGTCGGCTGG - Intergenic
1117424699 14:55581136-55581158 GGAAGTCTAGAGAAGTCGTCTGG + Intronic
1118745308 14:68768909-68768931 GGAAACCTGGAGAGGACATCTGG - Intergenic
1119422346 14:74514864-74514886 GGAAACCTGGAGAAGTGTGCGGG + Intronic
1119559507 14:75578934-75578956 GGAATCCTGGAGAAGTGGTGAGG - Exonic
1122711629 14:103662851-103662873 GAGGACCTGGAGAAGACTTCAGG + Exonic
1125427821 15:39567336-39567358 AAAGATCTGGAGAAGTCGGCCGG - Intergenic
1130085622 15:80776796-80776818 GAAAACCTGGAGTAGACGGGTGG - Intergenic
1130606497 15:85321969-85321991 GAAAAGCTGAAGAAGTCTCCAGG + Intergenic
1132163279 15:99563141-99563163 GAGAAGCTGGCCAAGTCGTCAGG + Intergenic
1139379243 16:66520149-66520171 GAAAACCTGGAGAAGCTGCGTGG + Intronic
1142789767 17:2255062-2255084 GAAAGTCTGGAGAAGTGGGCAGG + Intronic
1144022091 17:11246540-11246562 GAAGAACTGGAGAAGTCTTATGG + Intronic
1144791104 17:17859910-17859932 GAAAACCTGCTGGAGTCATCAGG + Intronic
1148080393 17:44964792-44964814 GAAAACCAGGAGAAATAGTGGGG - Intronic
1150267236 17:63839427-63839449 GGAAACCTGGAGCAGATGTCTGG - Intronic
1152219122 17:79051263-79051285 GAAACCCTGGGAAAGTCCTCAGG - Intergenic
1157287690 18:46388296-46388318 GCAAACCTGGAGAAGTTGGCAGG + Intronic
1159084033 18:63767244-63767266 GAAATCCAGGAGAAGCCCTCTGG - Intronic
1160298909 18:77661148-77661170 GAAAACCTTGAGCATTCGTCAGG - Intergenic
1165381213 19:35481846-35481868 GAAAACCTAAAGAAGTGGCCAGG - Intergenic
1167313752 19:48752395-48752417 GAAGACCTGGAGAAGAGGTTGGG + Intronic
1167876118 19:52414159-52414181 GGAAACCTGGATGAGTCGGCTGG - Intronic
1168613767 19:57821383-57821405 GAGAACCTGTAGATGGCGTCAGG - Intronic
1168617754 19:57852088-57852110 GAGAACCTGTAGATGGCGTCAGG - Intronic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
930131659 2:47858304-47858326 GAAAACTTGGATAAGTGGGCTGG - Intronic
931687921 2:64810442-64810464 GAAAACGTTGAGAAGACCTCAGG + Intergenic
933247348 2:79990345-79990367 GAAAACCTGGTGAGGTTATCTGG - Intronic
933728462 2:85439370-85439392 GGAAAGCTGGAGAGGTCGGCAGG + Intergenic
934760398 2:96852526-96852548 AAAAACCTGGAGAAGGGGGCAGG + Intronic
936275600 2:111094167-111094189 GAAAACCTGGAGAAGTCGTCAGG + Intronic
940545483 2:155078340-155078362 GAAAACCTGAAAAAGTCATTAGG + Intergenic
940613285 2:156018159-156018181 GAAAACAAGGAGAAGTTGTTTGG - Intergenic
948177589 2:235956406-235956428 GAAAGCCTGGGGAAGCCGTGGGG - Intronic
1170446863 20:16437340-16437362 GTAAACCTGGAAAAATGGTCTGG + Intronic
1171505349 20:25628549-25628571 GGAAACCTGGAGAGATCATCGGG + Intergenic
1174412464 20:50344800-50344822 GAGAACCTGGAGTCCTCGTCAGG + Intergenic
1175036448 20:56005061-56005083 GAAAAGGGGGAGAAGGCGTCTGG + Exonic
1175263084 20:57686914-57686936 GAGCAGCTGGAGAAGTCCTCTGG - Intronic
1178168718 21:30013249-30013271 GAAAACTTGGAAAAGTGGACAGG + Intergenic
1181752971 22:25002570-25002592 GAAAAACTGCAGATGTCCTCAGG + Intronic
1184022858 22:41832884-41832906 GAATGCCTGGAGTAGCCGTCCGG - Intergenic
1184234124 22:43174036-43174058 AAAAACCTGGAGAGGTCCTGCGG + Intronic
951411397 3:22371991-22372013 GGAAACCTGGCGAAGTTGTTGGG - Intronic
952097488 3:29970974-29970996 GAAAACCTGAAGAAGCTGGCGGG - Intronic
953075992 3:39570784-39570806 GAAAACCTGGAGAAGTGAAGGGG - Intergenic
953164991 3:40457182-40457204 GAAAACATGGCGGAGTCGGCTGG - Intergenic
960295851 3:115943223-115943245 GAAAGCCTGGGGAGGTCTTCTGG + Intronic
961026557 3:123563404-123563426 GAAAGACTGGAGAAGTGGGCAGG + Intronic
961465225 3:127077251-127077273 GTACTCCTGGAGAAGTAGTCTGG + Intergenic
965880154 3:173379596-173379618 GAAAACCTATAGAACTCTTCTGG - Intergenic
966979464 3:185117752-185117774 GACAAGCTGGAGAAGTAGGCAGG - Intronic
967720277 3:192808862-192808884 GTAAAACTGGTGAAGTCGGCTGG - Intronic
970248469 4:14089368-14089390 GTAATCCTGGAGAAGTTGCCTGG - Intergenic
970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG + Intergenic
973963925 4:56141066-56141088 GAATACCTGGAGAAGCCATGAGG + Intergenic
975977377 4:80114921-80114943 GAAAACATTGAGAAATCCTCTGG - Intronic
976388342 4:84484282-84484304 GAAAACATGCAGAAGTTGTAGGG - Intergenic
977627420 4:99202727-99202749 GAGAACTTGGAGGAGTCTTCGGG - Exonic
978275379 4:106942938-106942960 CAAGACCTGGAGAAGTAGGCAGG - Intronic
984504941 4:180605454-180605476 GGAAACCAGGAAAAGTCGTTGGG + Intergenic
993525555 5:88961431-88961453 TAAAACCTGGACCAGTAGTCAGG + Intergenic
998264648 5:140658862-140658884 GAGAATCTGGAGAAATGGTCAGG + Intronic
1000121949 5:158205956-158205978 GAAGAACTGGTGAAGTAGTCAGG + Intergenic
1000874731 5:166621950-166621972 TAAAGCCTGGAAAAGTCTTCTGG + Intergenic
1001042575 5:168347436-168347458 GAAATCCTAGAGAAGCAGTCAGG - Intronic
1001440517 5:171739262-171739284 GAAAGACTGGAGAAGTGGGCAGG - Intergenic
1002525774 5:179815434-179815456 GAAAACCTGGAGCAGGCATGGGG + Intronic
1004249301 6:14010022-14010044 GACAACCTGCAGATGTCATCAGG + Intergenic
1005303964 6:24495885-24495907 GAAAACCTGGAGAACGCTCCTGG - Intronic
1007538456 6:42618305-42618327 GAAAACCTGGAGGAGTAGGGTGG + Intronic
1007996010 6:46308684-46308706 GAAGACCTGGAAATGTGGTCAGG + Intronic
1012352715 6:98272569-98272591 GCAAACCTGGAGATTGCGTCTGG - Intergenic
1014232031 6:118914597-118914619 GAAAGCCTGGAGAAAAGGTCAGG + Intronic
1016040684 6:139429038-139429060 GAACATTTGGAGAAGTCATCAGG - Intergenic
1016962360 6:149686303-149686325 GATAAACTGGACAAGTCCTCTGG + Intronic
1018237105 6:161737192-161737214 GCACACCTGGTGAAGTCATCTGG + Intronic
1021023353 7:15632723-15632745 CAAAACCGGGACAAGTCTTCTGG + Intronic
1023968577 7:44976204-44976226 GGAAACCTGGAGAAGCTGGCAGG - Intronic
1031552731 7:123134536-123134558 GAAAACATGGAGACGTGTTCAGG + Intronic
1036063374 8:5351110-5351132 TAAAACCTGAAGAAGTGGCCTGG - Intergenic
1039731281 8:40281286-40281308 CAAAAACTGGAGAAGTTTTCTGG - Intergenic
1040581783 8:48704360-48704382 GAAAACCTGCAGGTGCCGTCAGG - Intergenic
1040582565 8:48709171-48709193 GAAAACCTGCAGGTGCCGTCAGG - Intergenic
1040750200 8:50696529-50696551 GAAAACCTAGGGATGTCTTCTGG - Intronic
1041401073 8:57445953-57445975 GAAAACCTGGATAAATCTTAGGG + Intergenic
1041671620 8:60497430-60497452 GAAAACCGAGAATAGTCGTCAGG + Intergenic
1043603035 8:81963806-81963828 GAAAACCTGTAAAAATAGTCTGG - Intergenic
1050844567 9:10198335-10198357 GAAAAACAGGAGTAGTGGTCAGG + Intronic
1053165087 9:35838892-35838914 GAAGAGCTGGAGAAGCCTTCAGG - Intronic
1058367426 9:104225642-104225664 GAGAACCTTGAGAAGTCCTGTGG - Intergenic
1060902658 9:127274371-127274393 GAAAATTTGGAGAAGTTGTCTGG - Intronic
1186259907 X:7766344-7766366 GAAAACCTGGAGAAGCCCATGGG - Intergenic
1186447671 X:9645344-9645366 GAAAACCTGGGAATGTCGGCTGG - Intronic
1186706048 X:12139720-12139742 GAAGACCTGGAGGAGTGCTCTGG - Intronic
1188005361 X:25012916-25012938 GCATACCTGGTGAAGACGTCCGG + Exonic
1190461219 X:50677824-50677846 TAAAACTTGGAGAATTGGTCAGG - Intronic
1193269771 X:79515515-79515537 GAAAACCGGTAAAAGTCCTCAGG + Intergenic
1199087881 X:143649997-143650019 GAAAATCTGGAGAACTCAGCAGG + Intergenic
1200162925 X:154018530-154018552 GAAAGGCTGGAGAAGTGGTGAGG + Intronic