ID: 936277785

View in Genome Browser
Species Human (GRCh38)
Location 2:111115684-111115706
Sequence CTGTTGCAGTCTAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936277782_936277785 6 Left 936277782 2:111115655-111115677 CCATTGAGACAATAATCATTCTG 0: 1
1: 0
2: 1
3: 17
4: 197
Right 936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG 0: 1
1: 0
2: 1
3: 19
4: 156
936277781_936277785 10 Left 936277781 2:111115651-111115673 CCGTCCATTGAGACAATAATCAT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG 0: 1
1: 0
2: 1
3: 19
4: 156
936277780_936277785 16 Left 936277780 2:111115645-111115667 CCGGATCCGTCCATTGAGACAAT 0: 1
1: 0
2: 0
3: 3
4: 60
Right 936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG 0: 1
1: 0
2: 1
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936277785 Original CRISPR CTGTTGCAGTCTAGGAAAAA TGG Intronic
901242083 1:7701321-7701343 CTGTTGCAGAGGAGGAAGAAGGG - Intronic
906462777 1:46049339-46049361 GTGTTTCAGTCTAAGACAAAAGG + Intronic
907013675 1:50990007-50990029 ATGTGGTAGACTAGGAAAAATGG + Intergenic
908429859 1:64045911-64045933 CATTTGCAGTCTAGGGAAGAAGG + Intronic
908747543 1:67390698-67390720 CTGCTGCAGCCCAGGAAAGAAGG + Intronic
911053391 1:93691322-93691344 CTGTTGCTGAGTGGGAAAAATGG + Intronic
912359048 1:109079550-109079572 AAGTTGCAGTGTAGGAGAAATGG + Intergenic
916102970 1:161408677-161408699 CTGTTAAACTCCAGGAAAAAGGG - Intergenic
918211915 1:182358678-182358700 GTGATGGAGTCAAGGAAAAAAGG + Intergenic
919731289 1:200915172-200915194 CTGTTCCAGTCCAGGTAACATGG - Intronic
923199021 1:231694049-231694071 CTGCTGCACTCTTGGAAACAGGG - Exonic
923463239 1:234225437-234225459 TTCATGCAGTCTAGGAAAAAGGG + Intronic
924417297 1:243870458-243870480 CTGTTGAACAATAGGAAAAAAGG + Intergenic
1063750789 10:8944306-8944328 CTGTAGAAGTCTAAGAAAGATGG + Intergenic
1066240920 10:33533926-33533948 CTGTTACAGTCTAAGAAATGTGG + Intergenic
1067287135 10:44914828-44914850 CAGTTGCAGGCTAGGAAAGCAGG + Intronic
1069637896 10:69936858-69936880 CTAATGCCTTCTAGGAAAAAGGG - Intronic
1074492297 10:113949168-113949190 CTCTTGCAGCCTGGGAAAAATGG - Intergenic
1075081884 10:119389751-119389773 TTGTTCCAGTGTAGGAAACATGG - Intronic
1077470207 11:2754500-2754522 ATGTTGCAGTGTAGGCACAAGGG + Intronic
1078313930 11:10275652-10275674 CTGTTGCAGCCTTGGAAATGAGG - Intronic
1078381383 11:10844724-10844746 ATTTTGTACTCTAGGAAAAAAGG - Intronic
1081072821 11:38631470-38631492 CTGGTGCAGGCTGGGAAAGAAGG - Intergenic
1082127743 11:48453120-48453142 CTGGTGATGTCTAGGAAAACAGG - Intergenic
1084544392 11:69807448-69807470 ATTATGCAGTCTATGAAAAATGG - Intergenic
1086847177 11:91765470-91765492 CTGTTACTGTATAGGAGAAAAGG - Intergenic
1088136891 11:106566552-106566574 ATGTTTGAGTCCAGGAAAAATGG + Intergenic
1089066969 11:115669618-115669640 CTGTAATAGTCTAGGAAAGAGGG + Intergenic
1089416522 11:118296613-118296635 CTGTGGCAGACTAGGGAGAAAGG + Intergenic
1093433821 12:19113050-19113072 CTGTTGCTGTAAAGGAACAACGG + Intergenic
1096738760 12:53676713-53676735 CTGGGACAGTCTAGGAATAACGG + Intronic
1098097557 12:66975114-66975136 CTGTTCCAGACTAGAAAAAAAGG + Intergenic
1098444233 12:70550029-70550051 TTCTTGCAGTCTAGTAAAGAGGG + Intronic
1101124156 12:101613973-101613995 CTCTTGCTTTCTGGGAAAAAGGG + Intronic
1101602206 12:106220373-106220395 AGGTTGCAGTCTAGGAGCAATGG - Intergenic
1103556313 12:121768779-121768801 CAGGGGCAGCCTAGGAAAAAAGG - Intronic
1105901358 13:24757161-24757183 GTGTTAGATTCTAGGAAAAAAGG + Intergenic
1106499965 13:30318465-30318487 CAGTGGCAGTTCAGGAAAAAGGG - Intergenic
1107412930 13:40174169-40174191 CACTTGCAGTCTGGAAAAAAGGG - Intergenic
1107459362 13:40586528-40586550 CTCTTGCAGTCTGGAATAAAAGG + Intronic
1108820585 13:54345080-54345102 CTGTTACAGAGTAGGAAAAATGG + Intergenic
1110877609 13:80528934-80528956 ATGATGCAATCTAGGAAGAAGGG - Intergenic
1112524759 13:100134335-100134357 CTGAAGCAGTTTTGGAAAAATGG - Intronic
1113817080 13:113179828-113179850 CTGTTGCAGTCTAAGAGAGAAGG - Intronic
1116220372 14:42077741-42077763 CTGGTACAGTCAAGGAAAACTGG + Intergenic
1117512038 14:56462089-56462111 CTTTTTCAGTCTAGGTACAAGGG + Intergenic
1118031523 14:61822588-61822610 CTGTTGCACTGTAGAAACAATGG + Intergenic
1121989802 14:98545112-98545134 CAGTGGGAGTCTAAGAAAAAAGG + Intergenic
1122112311 14:99510885-99510907 CAGTTGCAGTATGGGAAGAATGG + Exonic
1122455833 14:101850316-101850338 CTGTTGCAATACAGAAAAAATGG - Intronic
1128887974 15:71305711-71305733 CTGATGCTGTCCAGGAGAAATGG + Intronic
1133229344 16:4359321-4359343 CTGTTGCACTCCAGGAAGAAAGG + Exonic
1136784735 16:32927594-32927616 CTATGGCTGTGTAGGAAAAAGGG - Intergenic
1136885048 16:33926212-33926234 CTATGGCTGTGTAGGAAAAAGGG + Intergenic
1139141094 16:64263621-64263643 CTTTGGCTGTCTAGGAAAAAAGG - Intergenic
1139695985 16:68675308-68675330 ATGTTGCAGCCTAGCAAAAATGG + Intronic
1203087393 16_KI270728v1_random:1191600-1191622 CTATGGCTGTGTAGGAAAAAGGG - Intergenic
1147145037 17:38479736-38479758 CTATGGCTGTGTAGGAAAAAGGG - Exonic
1147407691 17:40224574-40224596 CTGTGACAGGATAGGAAAAATGG - Intronic
1148939080 17:51191516-51191538 GTTTTGCTTTCTAGGAAAAATGG + Intronic
1149115811 17:53094917-53094939 GTGTTGCAGCCTATGAGAAAAGG + Intergenic
1149811393 17:59676941-59676963 CAGTTTCAATCTAGGAAAAAAGG - Exonic
1150786273 17:68165484-68165506 CTTTTCCCGTTTAGGAAAAAAGG - Intergenic
1155934808 18:31743256-31743278 CTGTTGTAATCTAGGAACAGAGG - Intergenic
1158188853 18:54802599-54802621 CTCTAGCAGTTTAGGAAAATAGG - Intronic
1159173954 18:64810740-64810762 CTGTTGCAGGTTAGGAGAAAGGG + Intergenic
1163866271 19:19776132-19776154 CTATAGCAGTTTAGGAAAGAAGG + Intergenic
1163895257 19:20052682-20052704 CCATTGCAGTTTAGGAAAGAAGG - Intergenic
1164276689 19:23724835-23724857 TTGTTGCTGGTTAGGAAAAAAGG + Intergenic
1164718097 19:30408258-30408280 GTGTTGCATTCTAGTAAAATTGG + Intronic
1165583727 19:36893789-36893811 CTGTAGTGGTCTAGGAAAGAGGG - Intronic
926626714 2:15096588-15096610 CTTATGCAGTCTCGGACAAATGG + Intergenic
927523742 2:23719222-23719244 CTGTTACAGTCTTGGGAAGAAGG - Intergenic
928622845 2:33108475-33108497 CTGTTACATTCAGGGAAAAAGGG + Intronic
930315603 2:49793516-49793538 GTGCTGCAGTCGAGGAGAAAGGG + Intergenic
932617021 2:73239097-73239119 CAGCTGCAGTGTAGGAAAACAGG - Intronic
933109127 2:78374691-78374713 TCCTTGCAGTCTAGAAAAAATGG + Intergenic
933143256 2:78820077-78820099 CTGTTGCCATCTAGAAAACAAGG - Intergenic
936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG + Intronic
937411987 2:121684765-121684787 CTGTTAAACTCTAGAAAAAAGGG - Intergenic
937903779 2:127041775-127041797 CCGTGGCTGTCTAGGAAAAGAGG + Intergenic
938732855 2:134159987-134160009 CTGATGCAGTTTAGGATACATGG - Intronic
939153732 2:138501422-138501444 CTGTAGCAGTCTAGGAAGCCAGG - Intergenic
939692923 2:145288154-145288176 CTGTTGGAGTCTAAGGAAAGTGG - Intergenic
942629545 2:177940827-177940849 ATCTTGCAGTCTAGAAGAAATGG + Intronic
942813347 2:180022649-180022671 CTATTGAACTCTAGGAGAAACGG - Intergenic
943383156 2:187174658-187174680 CTGTTTCTGGTTAGGAAAAAAGG + Intergenic
946951198 2:224877191-224877213 ATTTTCCAGTCTAGGACAAAGGG + Intronic
947694252 2:232170263-232170285 CTGTTCCAGTTTAGCAACAAAGG - Intronic
1168907626 20:1418642-1418664 GTGCTGCAGGCTAGGAAAGAGGG - Intergenic
1169577284 20:6979240-6979262 CTGTAGCAGTAAAGGAAGAAAGG + Intergenic
1170379679 20:15743407-15743429 TTGACGCAGCCTAGGAAAAAAGG + Intronic
1171308093 20:24123225-24123247 CTGCTGGAGTGTAGGCAAAAAGG + Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1173010646 20:39178608-39178630 GTGTAGCAGTCAAAGAAAAAAGG + Intergenic
1173243163 20:41316220-41316242 CTGTTGCTGCCTTGGAAAGATGG - Intronic
1175342478 20:58242470-58242492 CTTTTGCACTCTAGGTAACAAGG + Intergenic
1177607729 21:23403172-23403194 CTGTTGCAGGATATTAAAAAGGG - Intergenic
1177676477 21:24307754-24307776 GTGTTGCTGTCAAGGAAAACTGG + Intergenic
1180588641 22:16916426-16916448 CTTTTCCAATCTTGGAAAAAAGG - Intergenic
1182903294 22:33916975-33916997 TTGTTGTGGTCTAGGAAAAATGG - Intronic
1182987437 22:34733692-34733714 CTGTTGCAGTTCAATAAAAAAGG - Intergenic
951503996 3:23421266-23421288 CTGTTACAGTCTAGCACAACTGG + Intronic
952947242 3:38486593-38486615 CTGTGGCAGACTGGGGAAAATGG + Exonic
955873352 3:63463150-63463172 CTTTTACAGTCGAGGGAAAAAGG + Intronic
958903773 3:99919701-99919723 CTGATGCAGTCTGGAAAAATAGG + Intronic
959951324 3:112183912-112183934 CTGTTCCAGTCCAGGTAACATGG + Intronic
964220505 3:154339341-154339363 ATGTTGTAGTCCAGAAAAAAAGG + Intronic
966068583 3:175846761-175846783 CTATTTCAGTGAAGGAAAAATGG + Intergenic
967245711 3:187484303-187484325 CTGAGGCAGTCTAGGAGAATTGG - Intergenic
968510298 4:992593-992615 CTGGTGCAGCCTGGGAAAAAGGG - Intronic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
970466926 4:16333498-16333520 CTGGTACAGTTTAGGAAAAGGGG + Intergenic
970601491 4:17643883-17643905 CTGATCCAGTCTAGGCAACAAGG + Intronic
970835797 4:20405377-20405399 GTTTTGAAATCTAGGAAAAAAGG + Intronic
972612483 4:40668497-40668519 CTGTAGGAGTATAGAAAAAAAGG - Intergenic
972909924 4:43801859-43801881 CTTAGGCAGACTAGGAAAAAAGG + Intergenic
973848393 4:54936281-54936303 CAGATGCAGTCTAAGAAAAGTGG - Intergenic
976896599 4:90119619-90119641 ATGTTGCAGTCTAAGCATAATGG - Intergenic
976939635 4:90683868-90683890 CTCTTTCAGTCAAGGAAACATGG - Intronic
977760774 4:100734039-100734061 CTGTAGGAGTTAAGGAAAAATGG + Intronic
981638861 4:146912486-146912508 CTGTTTCCGTGTAGGAAAATAGG + Intronic
986017755 5:3772677-3772699 ATGTTGCAGGATAGGAAAGATGG - Intergenic
986650203 5:9955828-9955850 CTTTTGCAGTCTAGGAAGATAGG - Intergenic
989124975 5:38044151-38044173 CTATTGCAATCTAGGTTAAAAGG + Intergenic
993399010 5:87425976-87425998 CTGTTTCAGTCAACGGAAAATGG + Intergenic
995510675 5:112906113-112906135 CCCTTGCAGTCTAGCCAAAATGG + Intronic
997726391 5:136123750-136123772 CTTTTGCACTCTAACAAAAATGG - Intergenic
1000088772 5:157911852-157911874 CTGATACAGTCCAGGAGAAATGG - Intergenic
1001178973 5:169500819-169500841 CTGTAACAGTGTAGTAAAAAGGG - Intergenic
1005131793 6:22517103-22517125 CTGTTGCAGCCAAGGAGAGAAGG - Intergenic
1010198815 6:73265002-73265024 CTAGTGCACTCTAGGATAAAAGG + Intronic
1010890822 6:81308434-81308456 CTGCTGCAGTTTAGAGAAAAGGG - Intergenic
1014479030 6:121912119-121912141 CTGTAGCAGCCTAGGACACAGGG + Intergenic
1014808136 6:125855007-125855029 CTTTTTCAGTCTAGGAAAGAGGG - Exonic
1017489807 6:154935020-154935042 TTGTTGGAATGTAGGAAAAAGGG + Intronic
1017524783 6:155232954-155232976 CACTTTCAGTCTAAGAAAAAAGG - Intronic
1018260015 6:161960830-161960852 CAATTGCAGTTTAGGAACAAAGG + Intronic
1019538601 7:1541377-1541399 CTGCTGCAGTCTAGGGAGAGGGG + Exonic
1020728134 7:11842587-11842609 TTGTTGCAGTCTGGGGCAAAGGG - Intergenic
1027399653 7:77794392-77794414 CTGTTGCAGGATCGGAAAAAAGG + Exonic
1027787310 7:82596826-82596848 ATGTTACAGACTAGGAAAAATGG - Intergenic
1028064477 7:86365381-86365403 CTCATGCAGACTAGAAAAAAAGG + Intergenic
1028550623 7:92058818-92058840 CTGTTCCAGTCCAGGAAAAAAGG + Intronic
1029064847 7:97839157-97839179 TAGTTGCAGTCTAGCAAAATGGG - Intergenic
1029931031 7:104370992-104371014 GTGTTGCAGTTTAAGAAAATGGG - Intronic
1030070388 7:105693055-105693077 TTGATGCACTCTGGGAAAAATGG - Intronic
1031367502 7:120920725-120920747 CTGTTGCAGTAAAGTAAAAGGGG - Intergenic
1031948093 7:127862151-127862173 CTTTAGCAGACTAGGAAAACTGG - Intronic
1032663170 7:134008263-134008285 CAGTTCCAGTTTTGGAAAAAGGG - Intronic
1034416419 7:150966771-150966793 CTGTTGGAGTCGGGGCAAAAGGG + Intronic
1034818333 7:154194015-154194037 CTGATGAAGTCTAGGAAAATGGG + Intronic
1041542131 8:58997189-58997211 CTGTAGCAGTCTATGAGGAAAGG + Intronic
1041970446 8:63735486-63735508 ATGTTACAGTATTGGAAAAAGGG - Intergenic
1042146725 8:65737474-65737496 CAGTTGCAGATTAGCAAAAATGG + Intronic
1042518178 8:69681744-69681766 CTGATATAGTCTATGAAAAATGG + Intronic
1047155837 8:122317137-122317159 TTGTCACACTCTAGGAAAAAAGG + Intergenic
1050727065 9:8662532-8662554 CTGATACAGCCTAGGAAAAATGG + Intronic
1050812530 9:9766712-9766734 CTGTTGCATGCTTGGAAATACGG - Intronic
1054978556 9:71176874-71176896 GTTTTGTAGTCTAGGAAGAATGG + Intronic
1056794396 9:89647655-89647677 CTGTTGCAGGCTGTGAAACACGG + Intergenic
1058471145 9:105280224-105280246 GTGTTGCAGTTTAGCAATAATGG + Intronic
1059664019 9:116428649-116428671 CTGTTGAAGCCTAGGAACTAGGG + Intronic
1059715239 9:116907246-116907268 CTGCTGCAGGCCAGGGAAAAGGG - Intronic
1060887841 9:127168153-127168175 CTGCTGCACCCTAGGAAGAAAGG - Intronic
1186299870 X:8188772-8188794 CTCTTGAAATCTAGTAAAAATGG + Intergenic
1189131526 X:38502952-38502974 CTCTTACAGTCTAAGAAAGATGG - Intronic
1189643710 X:43103257-43103279 ATGTTGGACTATAGGAAAAATGG - Intergenic
1191972272 X:66829696-66829718 GTGTTGCTGTCTAGGAGAAGAGG - Intergenic
1194634544 X:96328651-96328673 CTCTTTCAGTCTAGAAAATAAGG - Intergenic
1195109700 X:101635036-101635058 CTGTTGCACTAAAGGTAAAAGGG - Intergenic
1195839380 X:109156346-109156368 CAGATGTAGTCTAGGAAAATTGG + Intergenic
1197022268 X:121705848-121705870 CTGATGGATTCTAGGGAAAAAGG + Intergenic
1197236976 X:124078036-124078058 CTGTTGCAGACTGAGAATAAGGG - Exonic
1199243968 X:145581323-145581345 CTCTTACAGTGGAGGAAAAAAGG - Intergenic
1199336946 X:146629437-146629459 CTGTGGCAGTGTAGGAAACATGG + Intergenic