ID: 936279038

View in Genome Browser
Species Human (GRCh38)
Location 2:111122221-111122243
Sequence CAAAACAAGGACAAGTGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936279025_936279038 17 Left 936279025 2:111122181-111122203 CCAGGGCGGTGACGGCCGTTAGG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 936279038 2:111122221-111122243 CAAAACAAGGACAAGTGGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 181
936279028_936279038 2 Left 936279028 2:111122196-111122218 CCGTTAGGGTCTGCCCCCGACGG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 936279038 2:111122221-111122243 CAAAACAAGGACAAGTGGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 181
936279024_936279038 23 Left 936279024 2:111122175-111122197 CCACAGCCAGGGCGGTGACGGCC 0: 1
1: 0
2: 1
3: 26
4: 383
Right 936279038 2:111122221-111122243 CAAAACAAGGACAAGTGGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936279038 Original CRISPR CAAAACAAGGACAAGTGGCG AGG Intronic
901538017 1:9895782-9895804 CAAAACAAGGCCAGGTGCGGTGG - Intronic
902763023 1:18596700-18596722 CAAAACAAGGCCAGGTGCAGTGG + Intergenic
902829097 1:18998211-18998233 CAAAGCTAGGACTAGTGGCCAGG + Intergenic
903782129 1:25827429-25827451 CAAAAAAAGGAAAACTGGCTGGG - Intronic
904249864 1:29215581-29215603 CAAAACAAGGCCAAGCGTGGTGG + Intronic
905689517 1:39932626-39932648 CAAAACAAAAACAGGTGGCCGGG + Intergenic
907621674 1:55987588-55987610 CAAAACAAGGGTAAGGGGGGAGG + Intergenic
908553461 1:65233165-65233187 CAAAAGAAGGGAAAGTGGCCAGG - Intergenic
909442043 1:75707686-75707708 CAAAACAATGACAAGAGGATAGG - Intergenic
910028171 1:82683193-82683215 CCAAACAAGGAAAAGTGCTGGGG + Intergenic
912879628 1:113397326-113397348 GAAAACAAGGGCAGATGGCGTGG - Intronic
914688109 1:150000504-150000526 AAAAAACAGGACAAGTGGGGAGG + Intronic
915906000 1:159877587-159877609 CAAAATAAGGCCAGGTGCCGTGG + Intronic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
917493847 1:175522108-175522130 AAAAAAAAGGAGAAGTGGAGTGG - Intronic
918266811 1:182850302-182850324 CAAAAAAAAGAAAAATGGCGTGG + Intronic
919119708 1:193324047-193324069 CCAACCAAGGAAAAATGGCGGGG - Intergenic
919474962 1:198021539-198021561 CAAAAAGAGGACAAGAGGCCGGG - Intergenic
921158290 1:212454698-212454720 CAAAACAAGGCCAGGTGTAGTGG - Intergenic
921726854 1:218533692-218533714 GAAAGCCAGGACAAGTGGAGTGG + Intergenic
923913057 1:238471433-238471455 GAAAACAAAAACAAGTGGCCGGG + Intergenic
1062875339 10:938942-938964 GAAATAATGGACAAGTGGCGTGG + Intergenic
1063530438 10:6825845-6825867 CAAAACATGGACGGATGGCGAGG + Intergenic
1066413115 10:35192921-35192943 CAAAAGAGGGAGAAGTGGAGAGG - Intronic
1067459255 10:46445314-46445336 AAAAAAAAGCACAAGTGGCATGG - Intergenic
1067627942 10:47939316-47939338 AAAAAAAAGCACAAGTGGCATGG + Intergenic
1070042601 10:72796276-72796298 CAAAAAAAGGAAAATTGGCCAGG + Intronic
1073380219 10:103072541-103072563 CAAAACAAAGTCAGGTGGCAGGG - Intronic
1075784003 10:125036168-125036190 CAAAGCAAGAAAAAGTGGCATGG - Intronic
1077116276 11:886162-886184 AAAAAAAAGGAAAAATGGCGGGG + Intronic
1083472648 11:62894459-62894481 CAAAAAAAGAACAAGAGGCCGGG + Intergenic
1088559777 11:111101839-111101861 CAAAATACTGACAAGTGGCTGGG + Intergenic
1091794376 12:3289177-3289199 CAAAACCAAGACAAGTTCCGAGG - Intergenic
1093131560 12:15398019-15398041 CAAAACAGGGGCATGAGGCGAGG + Intronic
1094542405 12:31373322-31373344 CAAAAAAAGGGCAAATGGCCGGG - Intergenic
1097072814 12:56367785-56367807 CAAAAAAAAGACATGGGGCGGGG + Intergenic
1102875063 12:116442872-116442894 CAAAACAAGGCCAGGTGTGGTGG - Intergenic
1103984426 12:124757997-124758019 AAAAACAAGGATAAATGCCGTGG + Intergenic
1103994606 12:124820953-124820975 CAAAACAAGGCCCAGTGCGGTGG + Intronic
1104072652 12:125359790-125359812 CAAAACAAGGCCAGGTGCAGTGG + Intronic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1105825033 13:24114955-24114977 CAAAACAAAGCCAAGGGGCTGGG - Intronic
1106272744 13:28170114-28170136 CAAAACAAGGGTAGGTGGCAAGG - Intronic
1106386138 13:29288046-29288068 CAAAAGGAGGACAAGTGTAGAGG + Intronic
1107849568 13:44557165-44557187 CAAAAAAAGAAAAAGTGGCCGGG + Intronic
1109095372 13:58107554-58107576 CAAAACAAGCACAAGTACTGAGG + Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1109708434 13:66130435-66130457 TAAAAGAAGGAAAAGTGGCCGGG - Intergenic
1115386210 14:32800584-32800606 CAAAACAAGGAAAATTATCGGGG - Intronic
1120509399 14:85395448-85395470 GAACACATGGACAAGTGGAGGGG - Intergenic
1121358810 14:93236252-93236274 CAAAACAAGGCCAGGTGCGGTGG - Intergenic
1122514187 14:102294968-102294990 TAAAACAAGGATAAGAGGCAGGG + Intronic
1122737644 14:103852606-103852628 AAAAACAAGGAAAGCTGGCGAGG - Intergenic
1125900548 15:43342459-43342481 AAAAAAAAGGACAAGTGTAGTGG + Intronic
1126554832 15:49974383-49974405 AAAAAAAAGGACAAGTGGCTGGG - Intronic
1126708213 15:51427498-51427520 CAAAACAAGGACAAGGCCCTAGG + Intergenic
1130299180 15:82667072-82667094 CAGAACAAGGGCAGGTGGGGAGG - Intronic
1130764336 15:86854965-86854987 CTAAACTAGGACCAGTGGGGGGG - Intronic
1131015018 15:89050802-89050824 GAAAACATGCACAAGTGGCCAGG + Intergenic
1132026148 15:98405980-98406002 CAATACAAAGACATGGGGCGAGG + Intergenic
1133280670 16:4663348-4663370 AAAAACAAGGCCAGGTGCCGTGG - Intronic
1134858909 16:17543497-17543519 CAAAAGAAGGCAAAGTGGGGCGG + Intergenic
1135467921 16:22703083-22703105 TAAAACAAAAACAAGTGGCAGGG - Intergenic
1135527941 16:23228285-23228307 CAAAAGTAGGAAAAGTGGAGGGG - Intergenic
1135550196 16:23391885-23391907 CATAACAAGGCCATGTGGCCAGG - Intronic
1136013038 16:27376977-27376999 CAAAACAAGGCCAGATGGGGTGG + Intergenic
1136182560 16:28564109-28564131 TAAAACAATGACAAGTGTGGTGG + Intronic
1137651303 16:50122852-50122874 AAAAACAAAAACAAGTGGCTGGG + Intergenic
1139762009 16:69191926-69191948 CAAAACAAGGCCAGGTGCGGTGG - Intronic
1140427275 16:74871309-74871331 CAATACAAGGCCAAGTGGGGTGG - Intergenic
1141635006 16:85309946-85309968 ATAAAAAAGGAGAAGTGGCGGGG + Intergenic
1141680648 16:85541809-85541831 CACACCAAGGACAAGCAGCGAGG - Intergenic
1141711229 16:85700273-85700295 CAAAACAAGGCCAGGTGCGGTGG + Intronic
1144766727 17:17737302-17737324 CAAAACAAGGACCACAGGTGGGG - Intronic
1144896600 17:18540761-18540783 CAACACATGGACACATGGCGGGG + Intergenic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1146890907 17:36505974-36505996 CTAAACTAGGAAAAGGGGCGTGG + Intronic
1148261004 17:46183539-46183561 CAAAAGAAGGAAAAGAGGAGAGG + Intronic
1149496795 17:57123580-57123602 TAAAACAAGGAAAACTGGCCAGG + Intergenic
1151247054 17:72803179-72803201 CACAACAAGGGCAGGAGGCGAGG - Intronic
1152461356 17:80444074-80444096 CAAAACAAACGCAAGTCGCGAGG + Intergenic
1152711936 17:81875717-81875739 CAAAAAAAGGCCAAGTGCGGTGG + Intergenic
1155210120 18:23593278-23593300 CCAGACAAGGACAAGAGGAGGGG + Intergenic
1156128888 18:33943545-33943567 CAAAACAAAAACAAGTGACAGGG + Intronic
1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG + Intronic
1158123032 18:54071066-54071088 CAAAACAAGGTCATGTGGTGAGG - Intergenic
1158714949 18:59870331-59870353 CAAAACAAGGCCAGGTGCAGTGG - Intergenic
1160982037 19:1820703-1820725 CAAAACAAGGCCAAGCGTGGTGG + Intronic
1163689003 19:18728373-18728395 CAAAACCAGGACAATGGGCTTGG + Intronic
1163788563 19:19291592-19291614 CAAAAAAAGGCCAAGAGGCTGGG + Intronic
1165548167 19:36559961-36559983 AAAAACAAAGAGAAGTGGCCTGG + Intronic
1166142873 19:40814543-40814565 AAAAACAAAGAGAAGTAGCGAGG - Intronic
930443190 2:51435002-51435024 CAAAACAAAGAAAACTGGCATGG + Intergenic
931369635 2:61650260-61650282 CAAAAAAAGGCCAAGTGTGGTGG + Intergenic
932023784 2:68113848-68113870 CAAAACAAGGCCAGGTGCGGTGG + Intergenic
933315361 2:80707926-80707948 AAAAACAAAGATAAGTGGCCAGG - Intergenic
935164762 2:100560950-100560972 CAAAACAAGGCCAGGTGCGGTGG + Intergenic
936279038 2:111122221-111122243 CAAAACAAGGACAAGTGGCGAGG + Intronic
938430761 2:131235506-131235528 AAAAATAAGGACAAGTGTGGTGG + Intronic
938700352 2:133872520-133872542 TAAAACAAAGACAAGGGGCTTGG - Intergenic
939180259 2:138795328-138795350 GAAAACAAAGAAAAGTGGGGTGG - Intergenic
944819375 2:203414387-203414409 CAAAACAAGGCCAGGCGGGGAGG - Intronic
944982538 2:205137915-205137937 CAAAACAAGGTCAAGTCACAAGG + Intronic
946754797 2:222933140-222933162 CAAAACAAAGAAAGGTGGAGAGG - Intronic
947135298 2:226971442-226971464 CAAAACAATGAGAAATGGGGAGG - Intronic
1170719014 20:18859084-18859106 CAAAAAAAAGAGAAGTTGCGTGG + Intergenic
1171269878 20:23806431-23806453 CAAAAAACGGACAAGTGCAGTGG - Intergenic
1172652611 20:36514699-36514721 CAAAACAAGGACAGGCGCGGTGG - Intronic
1173282632 20:41643115-41643137 CAAAACATGGTCAAGGGGCCGGG - Intergenic
1175213121 20:57374165-57374187 GAAAACAAGGCCAAGTGCGGTGG - Intronic
1175762238 20:61569105-61569127 CCACAGCAGGACAAGTGGCGCGG - Intronic
1176158340 20:63634901-63634923 AAACACAAGGACAAGAGGCCAGG - Intergenic
1178179215 21:30140635-30140657 CAAAACAAGGACATGGGCCTTGG + Intergenic
1179391835 21:41000457-41000479 AAAAATAAGGATAATTGGCGGGG - Intergenic
1179515022 21:41900423-41900445 CAAAATAAGGACAAGACTCGTGG - Intronic
1183588354 22:38766191-38766213 CAAAAAAAAGACAACTGGCCTGG + Intronic
949254930 3:2034890-2034912 CAAAATAAGGAAATGGGGCGAGG + Intergenic
951406006 3:22297691-22297713 CAAAGCAAATACACGTGGCGAGG + Intronic
953165722 3:40463194-40463216 CAAAAAAAGGCCAAGTGCAGTGG - Intergenic
953992384 3:47494377-47494399 CAAAACAAAGAAAAGAGGCTGGG + Intergenic
954651313 3:52165052-52165074 CAAAACAGGGCCAGGTGGGGTGG - Intergenic
954973055 3:54667655-54667677 CAAAATAAGGTCAGGTGCCGTGG + Intronic
956179676 3:66505369-66505391 CAAGGCAAGGACAAGTGTCAAGG - Intergenic
959888729 3:111530692-111530714 CAAAACAAGCCCCAGTGGAGAGG + Intronic
960242911 3:115366444-115366466 GAAAACATGGACAAATGGTGGGG + Intergenic
960447921 3:117770429-117770451 CAAGCCAAGGACAAATGGCTTGG - Intergenic
962723231 3:138195836-138195858 CAACAAAATGACAAGTGGTGGGG - Intronic
963039663 3:141059479-141059501 GAAAACAAGAGCAAGAGGCGGGG + Intronic
963827852 3:149973531-149973553 GAAAACAAGCACAGGTGGCCGGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
971308301 4:25502867-25502889 AAAAACAAGGCCGAGTGGGGTGG + Intergenic
971854418 4:32025090-32025112 CAAAAAAGGGACAAGTGCCTTGG - Intergenic
973621909 4:52735326-52735348 CAAAACAAAGACTAGAGGCTGGG + Intronic
973944750 4:55945095-55945117 CAAAAGAAGGACAAGAGTCACGG - Intergenic
975762729 4:77634511-77634533 CAAGACCAGGACAAATGGTGGGG + Intergenic
978954387 4:114596751-114596773 TAAAAAAAGGAAAAGTGGGGTGG + Intergenic
980732633 4:136842779-136842801 AAAAAAAAGGACAAGTGCGGTGG - Intergenic
981657693 4:147130651-147130673 TACAGCAAGGACAAGTGGGGAGG - Intergenic
984426905 4:179598802-179598824 CAAGACAAGAACAGGTGGTGGGG - Intergenic
986202638 5:5591948-5591970 CAAAACAAGCACAAGAGACATGG - Intergenic
987256112 5:16153322-16153344 GAAAACAAGGACAACTGGTTTGG + Intronic
988841413 5:35087283-35087305 AAAATCAAGGAAAAGTGGCCAGG - Intronic
988861359 5:35283597-35283619 AAAAACAAGGAAAAGTGGCTAGG + Intergenic
989410865 5:41118990-41119012 CAAAACAAGGACTAGAGGCCGGG - Intergenic
993585659 5:89724528-89724550 CAAATCAATCACAAGTGGAGAGG - Intergenic
996827366 5:127700439-127700461 AAAAACAATGACAAGTGACCTGG + Intergenic
997485024 5:134223953-134223975 GAAAACAAGGACAAGTGAAGTGG + Intronic
997536583 5:134627344-134627366 CAAAAAAATAAAAAGTGGCGGGG - Intronic
999864134 5:155682483-155682505 TAAAACAAGGTCAAGTGCAGTGG - Intergenic
1000019767 5:157309240-157309262 AAAAACCAGGGCAAATGGCGGGG - Intronic
1001259601 5:170216560-170216582 CAAAACAATGAACAGTGGCCAGG - Intergenic
1001357760 5:171047303-171047325 CAAAATAAGGCCAAGTGCAGTGG - Intronic
1002045283 5:176537917-176537939 ATAAACAAGGAGAAGTGGGGCGG - Intronic
1004251123 6:14023927-14023949 CAAAAAAAGAGCATGTGGCGGGG - Intergenic
1005730360 6:28691277-28691299 CAAAATATGGACAGATGGCGAGG - Intergenic
1006210497 6:32389522-32389544 CAAAACAGGAACAAATGGGGTGG + Intergenic
1006412070 6:33879696-33879718 CAAAACAAGGAAATGTTTCGAGG + Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1011544077 6:88465502-88465524 CGACACAAGGACATGTGGGGTGG + Intergenic
1012870687 6:104669836-104669858 GAACACATGGACACGTGGCGGGG + Intergenic
1015610012 6:135006859-135006881 TACAACAAGGAAAAGTGGCATGG + Intronic
1017155810 6:151321857-151321879 AAAAACAGGGGCAGGTGGCGGGG - Intronic
1020875166 7:13684499-13684521 CCAAACAAAGAGAAGTGGCAAGG - Intergenic
1021181706 7:17514189-17514211 CAAAACAAGGCCGGGTGGGGTGG - Intergenic
1021473679 7:21035710-21035732 AAAAACAAGGATAAGTAGCTGGG - Intergenic
1023226563 7:37975807-37975829 TAAAAGAAGGGCAAGTGGCCAGG + Intronic
1026762859 7:73139609-73139631 CAAAAAAAGGCCAGGGGGCGTGG - Intergenic
1029304601 7:99609727-99609749 AAAAAAAAGAACAAGTGGCCGGG - Intergenic
1036490567 8:9221407-9221429 CAAATTAAGGAAATGTGGCGTGG + Intergenic
1045345778 8:101292260-101292282 CCAAACAAGTCCAAGTGGAGAGG - Intergenic
1045445717 8:102261405-102261427 CAAAAAAAGGACAAGCCGCCAGG + Intronic
1045527682 8:102955387-102955409 CAAAAGATGGAGAAGTGGCTGGG - Intronic
1046696114 8:117341459-117341481 CAAAAAAATGACAAGTTGTGAGG + Intergenic
1046976736 8:120286802-120286824 TAAAATAATGACAAGTGGCCAGG - Intronic
1048529239 8:135232712-135232734 CAAAGCAAGTACTAGTGGCCCGG - Intergenic
1052845066 9:33328310-33328332 CAAAAAAAGGCCAAGTGTGGTGG - Intronic
1053234450 9:36440245-36440267 CAAAAAAAGAAAAAGTGGCAGGG + Intronic
1058114830 9:101073075-101073097 TAAAACAAAGACAATTGGAGAGG + Intronic
1059225974 9:112673289-112673311 CAACACATGGACACGTGGTGGGG - Intergenic
1060864926 9:126988126-126988148 AAATACAAGGACCAGTGGTGAGG + Intronic
1061599629 9:131659149-131659171 CATAAAAAGGACAAATGGAGTGG + Intronic
1062626184 9:137442850-137442872 TAAAACAAGGACAGCTGGCTGGG - Intergenic
1188078752 X:25809922-25809944 CACAACCAGGACAATTGGCATGG + Intergenic
1190713361 X:53084901-53084923 CAAAACAAGGACAGATTGAGGGG - Intronic
1193021667 X:76799132-76799154 CAAAACCATGACAAATGGTGGGG - Intergenic
1196573593 X:117292165-117292187 CAAAAAAAGGAAAACTGGCTGGG + Intergenic
1197549793 X:127876315-127876337 AAAAAAAAAGACAAGTGGTGAGG - Intergenic
1199393050 X:147304437-147304459 GAAAACATGAACAAGTGGAGAGG + Intergenic