ID: 936279176

View in Genome Browser
Species Human (GRCh38)
Location 2:111122737-111122759
Sequence GCGGGCTGGCGGGAAGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 444}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936279164_936279176 3 Left 936279164 2:111122711-111122733 CCTCGGCTGCCCGGCGGAGCGCG 0: 1
1: 0
2: 1
3: 18
4: 151
Right 936279176 2:111122737-111122759 GCGGGCTGGCGGGAAGGCGCGGG 0: 1
1: 0
2: 6
3: 38
4: 444
936279163_936279176 4 Left 936279163 2:111122710-111122732 CCCTCGGCTGCCCGGCGGAGCGC 0: 1
1: 0
2: 2
3: 10
4: 90
Right 936279176 2:111122737-111122759 GCGGGCTGGCGGGAAGGCGCGGG 0: 1
1: 0
2: 6
3: 38
4: 444
936279169_936279176 -6 Left 936279169 2:111122720-111122742 CCCGGCGGAGCGCGGCGGCGGGC 0: 1
1: 1
2: 1
3: 43
4: 365
Right 936279176 2:111122737-111122759 GCGGGCTGGCGGGAAGGCGCGGG 0: 1
1: 0
2: 6
3: 38
4: 444
936279159_936279176 25 Left 936279159 2:111122689-111122711 CCAGAGGCGCGGCGTGCGGAGCC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 936279176 2:111122737-111122759 GCGGGCTGGCGGGAAGGCGCGGG 0: 1
1: 0
2: 6
3: 38
4: 444
936279170_936279176 -7 Left 936279170 2:111122721-111122743 CCGGCGGAGCGCGGCGGCGGGCT 0: 1
1: 0
2: 0
3: 12
4: 174
Right 936279176 2:111122737-111122759 GCGGGCTGGCGGGAAGGCGCGGG 0: 1
1: 0
2: 6
3: 38
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936279176 Original CRISPR GCGGGCTGGCGGGAAGGCGC GGG Intronic