ID: 936280457

View in Genome Browser
Species Human (GRCh38)
Location 2:111135677-111135699
Sequence GGTGCCCAGACACCCAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936280451_936280457 7 Left 936280451 2:111135647-111135669 CCAGATGGGGCGAAGACTCAGTA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 936280457 2:111135677-111135699 GGTGCCCAGACACCCAAGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936280457 Original CRISPR GGTGCCCAGACACCCAAGGC TGG Intronic
900252508 1:1678462-1678484 GGTGCACAGACACACACAGCAGG - Intronic
900624652 1:3602671-3602693 GATGAGCTGACACCCAAGGCTGG - Intronic
900656691 1:3762213-3762235 GCTGCCTAGACACACAGGGCGGG + Intronic
901831932 1:11898259-11898281 GATGCCCAGACGCCTAAGCCTGG + Intergenic
902513377 1:16977909-16977931 GGTGCAGGGGCACCCAAGGCAGG - Intronic
902882963 1:19384976-19384998 GGTGATCAGACACCCAGGGCAGG + Intronic
903943872 1:26949925-26949947 GGAACCCAGTCAGCCAAGGCAGG + Exonic
904267010 1:29323930-29323952 GCTGCCCAACCAGCCAAGGCTGG + Intronic
904587674 1:31588984-31589006 GGTCCCCAGGGAGCCAAGGCCGG + Intergenic
904617063 1:31755616-31755638 GGTGCACAAAGGCCCAAGGCTGG - Intronic
905923814 1:41736086-41736108 GGCTCCCAGACACCCTGGGCGGG - Intronic
906296547 1:44652281-44652303 TGTGCTCAGAGAACCAAGGCTGG + Intronic
912439468 1:109687628-109687650 GGCGCCCAGAAGCCCAAGGCGGG - Intronic
912442774 1:109712068-109712090 GGCGCCCAGAAGCCCAAAGCGGG - Intergenic
912488058 1:110044943-110044965 GGATCCCAAACACCAAAGGCCGG - Intronic
915502157 1:156327000-156327022 TGTGCCCAGGCACCCCAGCCTGG + Intronic
916164686 1:161955467-161955489 GATGCCCAGCCACCCAGGGGAGG + Intronic
916187067 1:162144008-162144030 GGTGCCATGACACCGAAGGAGGG - Intronic
918043508 1:180927359-180927381 CCTGCCCTGAGACCCAAGGCAGG + Intronic
919042094 1:192402119-192402141 GGTGCCCAGACAGTCATGTCAGG - Intergenic
919463171 1:197902620-197902642 GGTGCTCCGCCTCCCAAGGCCGG + Intergenic
919784261 1:201249181-201249203 GGTGCCAAACCACCCACGGCTGG + Intergenic
920665353 1:207959339-207959361 GGGGCCGAGACAGCCAAGCCCGG - Intergenic
923105625 1:230851343-230851365 AGAGCCCAGCCAACCAAGGCTGG + Intronic
1063144483 10:3284392-3284414 GGGGCCCCAACACGCAAGGCCGG - Intergenic
1064027469 10:11860145-11860167 TGTGCCCTGAGTCCCAAGGCAGG - Intronic
1066426537 10:35312480-35312502 GGTGCCCTCACACCCAATTCAGG + Intronic
1067165633 10:43864433-43864455 GGTGTCCTCCCACCCAAGGCAGG - Intergenic
1069833285 10:71293949-71293971 GGTGCCCACACAGCCCTGGCCGG + Intronic
1070986914 10:80697085-80697107 GGTGCCCAGGGACCCAAGAGGGG - Intergenic
1071229144 10:83564816-83564838 GGCGCCAAGACACCAAAGGAAGG + Intergenic
1072453233 10:95555760-95555782 GGTGCCCACCCTCCCAAGGTGGG + Intronic
1072692710 10:97582440-97582462 GCTGCCCACACACCCATGGCGGG - Intronic
1073424041 10:103445597-103445619 AGTGCCCAGGCACTCGAGGCGGG - Exonic
1075080676 10:119381624-119381646 GGTGCCCAGGCTCCCCGGGCAGG - Intronic
1075403038 10:122174370-122174392 TGTGCCCAGAAACCTAGGGCAGG - Intronic
1076359296 10:129875699-129875721 GGTGCTGAGATACCCAAGGCTGG - Intronic
1076539716 10:131206386-131206408 GGGCCCCAGACAGCCAAGGAAGG + Intronic
1076698992 10:132260503-132260525 GGTGCCCAGCATCCCAAGACCGG - Intronic
1076721073 10:132393531-132393553 GGTGCCCAGAGGCCAAAGGCAGG - Intergenic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1077019045 11:409416-409438 GGCCCCAAGACCCCCAAGGCAGG - Intronic
1077224568 11:1434508-1434530 GGTGCGCCGACACCCAGAGCCGG - Intronic
1077224643 11:1434725-1434747 TGCGCCCAGACACCCAGAGCCGG - Intronic
1077368147 11:2169535-2169557 GCTGCCCAGGCCCCCGAGGCCGG - Intronic
1079134813 11:17770425-17770447 GGGGCCCATCCACCCAGGGCAGG + Intronic
1079155867 11:17947536-17947558 TGTGCCCAGACACCAAGGGAGGG + Intronic
1080698257 11:34621773-34621795 AGTGGCCAGGCAGCCAAGGCAGG + Intronic
1081967024 11:47176457-47176479 GTTGCCCAGACACCCCTGGCCGG + Intronic
1082749623 11:57002203-57002225 CATGCCCAGGCACCCAAGCCAGG + Intergenic
1083311435 11:61785893-61785915 GGTGCCCAGACCTCCAGGGTAGG - Intronic
1083417194 11:62533434-62533456 GAGGGCCAGACACCAAAGGCAGG - Exonic
1084178331 11:67434756-67434778 GTGGCCAAGGCACCCAAGGCTGG - Intronic
1085052083 11:73385082-73385104 GGTGCCCTGACACCCAGTTCTGG - Intronic
1089535218 11:119156787-119156809 CTTCCCCACACACCCAAGGCGGG + Intronic
1089921524 11:122213558-122213580 GGTTCCCAGCCACCCCAGGGAGG - Intergenic
1090077119 11:123586541-123586563 GGTGCCCTGTCACCCGAGGGCGG - Intronic
1091315156 11:134609506-134609528 GGTCCCCGCGCACCCAAGGCCGG - Intergenic
1091321563 11:134655800-134655822 GCTGCCCTCACCCCCAAGGCCGG - Intergenic
1091583195 12:1800933-1800955 TGGGGCCAGACACCCAAGGTGGG + Intronic
1093011507 12:14111901-14111923 GGTGCCAAGACTCCCAAGCAGGG - Intergenic
1093370140 12:18355670-18355692 CATGCCCAGGCACCCAAGCCTGG + Intronic
1097008713 12:55937464-55937486 TGTTCCCAGACACCTAAGCCTGG + Exonic
1100031953 12:90203470-90203492 AGTGCCCAGACACATAAGGAAGG + Intergenic
1101838741 12:108312889-108312911 GCTGGCCAGACTCCCAGGGCAGG + Intronic
1102720638 12:115013295-115013317 GGAGCCCAGAGACCCTGGGCTGG - Intergenic
1103534916 12:121627458-121627480 TGTGCCCCGGCACCCGAGGCCGG + Intronic
1104855899 12:131902406-131902428 CGTGCCCAGACACCCGTGCCAGG + Intronic
1108357964 13:49644045-49644067 GAGGCCCACACACCCCAGGCGGG + Intergenic
1108486624 13:50933293-50933315 GGTGCCCAGAGTGCCAAGACAGG - Intronic
1109208451 13:59507527-59507549 GGTGCCCAGAAAACCAAGTGTGG + Intergenic
1111526527 13:89478056-89478078 TGTGCTCAGAGACCCAGGGCAGG + Intergenic
1113983549 13:114295939-114295961 GTTGGCCAGAAAGCCAAGGCAGG + Intronic
1118117923 14:62802468-62802490 GGCGCGCAGACACCCATCGCTGG + Exonic
1118162255 14:63302102-63302124 GGTGTCCAGACTCCACAGGCCGG + Intergenic
1118473451 14:66095323-66095345 TGTGCTCAGACACCCCAAGCAGG - Intergenic
1119774854 14:77242111-77242133 GGTGCCTAGACTGCCCAGGCAGG - Intronic
1121334010 14:93065731-93065753 GGTCCAGAGACACCCAGGGCAGG + Intronic
1121643962 14:95505079-95505101 GTTGCCCGGAGTCCCAAGGCAGG - Intergenic
1122578233 14:102755250-102755272 CTGGCCCAGACACCCAGGGCAGG - Intergenic
1122741091 14:103872014-103872036 GGTGCCCCGCCACCCACGGGGGG + Intergenic
1122954814 14:105065697-105065719 TGTCCCCAGACAGGCAAGGCAGG + Intergenic
1129485658 15:75869549-75869571 GGTCCTCAGACACCCAATGTTGG - Intronic
1129901730 15:79156729-79156751 GATGCCCAAACTGCCAAGGCTGG - Intergenic
1130652300 15:85768930-85768952 TGTGCCCGGCCACGCAAGGCGGG - Exonic
1130915994 15:88305025-88305047 GGGGCCCACACAACCTAGGCAGG + Intergenic
1132548863 16:546027-546049 GGAGCAGAGAGACCCAAGGCCGG - Intronic
1132664018 16:1073477-1073499 GGTTCCCTGAAACCCAAGACTGG + Intergenic
1136589300 16:31207853-31207875 GGTGCCATTACACCCCAGGCTGG - Intergenic
1137731159 16:50691643-50691665 GGTGCACAGTCAGCCAAGGTTGG - Intergenic
1138235568 16:55379727-55379749 AGGGCCAAGCCACCCAAGGCTGG - Intergenic
1139325770 16:66151599-66151621 GTGGCCCAGGCAGCCAAGGCCGG + Intergenic
1142749203 17:1977537-1977559 GGGTCCCAGACACCCCAGGCCGG - Intronic
1146055268 17:29577775-29577797 GGTGGCCAGGCCCCCAAGGTGGG + Intronic
1148451431 17:47780779-47780801 GGTCCCCAGACTCCTGAGGCTGG + Intergenic
1148793351 17:50185752-50185774 AGTGCCCAGAATCCCCAGGCAGG - Intronic
1149491239 17:57086152-57086174 GGTCGGCAGACACCCCAGGCTGG - Intronic
1152120384 17:78414765-78414787 CGTGTCCAGGCACCCAGGGCAGG + Intronic
1152471228 17:80491036-80491058 GGTGGCCAGTCACCCAGGGGTGG + Intergenic
1153139426 18:1954704-1954726 GGTGCCCAAACCCCAGAGGCGGG + Intergenic
1156466494 18:37350925-37350947 GCTCCCCAGAGACCCAAGACTGG - Intronic
1157149484 18:45202168-45202190 TGTGCCCAGACTCCAAAGTCTGG + Intergenic
1157331267 18:46705506-46705528 GGTGCCCAGACCCCCGGAGCTGG + Intronic
1157476780 18:48028889-48028911 GGTGCCCAGCCAGCCACAGCAGG - Exonic
1160805191 19:989550-989572 GGTGCCCACCCAGCCCAGGCAGG + Intronic
1161510743 19:4669873-4669895 GGTGCCTGGACACTCCAGGCAGG + Intronic
1162149450 19:8634363-8634385 TGAGCCCAGACATTCAAGGCTGG - Intergenic
1162495674 19:11022106-11022128 GGAGCCCTGGAACCCAAGGCTGG + Intronic
1162799844 19:13104381-13104403 GCTGCCCAGACACCCAGTGAGGG - Intergenic
1163191262 19:15678547-15678569 GGTGCCCAGAACACCAAGACAGG - Intronic
1163584086 19:18154618-18154640 GGTGGCCAGATACCTAGGGCAGG - Intronic
1163721054 19:18898499-18898521 GGGGACCAGGCACCCAAGGCTGG + Intergenic
1166170464 19:41024709-41024731 GGTGTTCAGACATTCAAGGCAGG + Intergenic
1166758862 19:45212281-45212303 GCTTCTCACACACCCAAGGCCGG - Intronic
1167323450 19:48810597-48810619 GGGGCCCAGACCTCCAGGGCCGG - Intronic
925387599 2:3472981-3473003 GGTGCTAAGACACCGAGGGCGGG + Intronic
926440519 2:12884103-12884125 AGTACACAGACTCCCAAGGCAGG - Intergenic
927103761 2:19807319-19807341 GAGGCAGAGACACCCAAGGCTGG + Intergenic
927211050 2:20639121-20639143 GGTGCCCAGACTCTCGGGGCAGG - Intronic
927481363 2:23456821-23456843 GGGGTCCAGTCACCCAGGGCTGG + Intronic
927939800 2:27096319-27096341 GGGGACCAGACAGCCCAGGCAGG + Intronic
929020101 2:37544979-37545001 GATGGCCACACACCCTAGGCAGG - Intergenic
932194217 2:69769105-69769127 GGTGCCCAGAAAAACAAGGTAGG + Intronic
933779243 2:85790143-85790165 TGTGACCACAAACCCAAGGCTGG - Intergenic
936280457 2:111135677-111135699 GGTGCCCAGACACCCAAGGCTGG + Intronic
936404708 2:112192432-112192454 GATACCCAGATACCCAAGTCAGG - Intergenic
938136746 2:128765534-128765556 GGTTGCCAGACACCCTATGCAGG - Intergenic
938684777 2:133727647-133727669 TATGCCCAGACACCCTAGGAAGG + Intergenic
939043164 2:137216604-137216626 GGTGCCCAGATGTCCAAGGATGG + Intronic
939769518 2:146298563-146298585 GGTGCACAGACTCCACAGGCAGG + Intergenic
941010993 2:160298969-160298991 TCTACCCAGACACCCAAGCCAGG - Intronic
944323887 2:198380657-198380679 TGTGCCTAGAGAGCCAAGGCAGG - Intronic
945700740 2:213168257-213168279 GATAGCCAGACAGCCAAGGCTGG + Intergenic
946878569 2:224155229-224155251 CCTGCACAGGCACCCAAGGCTGG - Intergenic
947502752 2:230683432-230683454 GGTGCCCAGAGGCCCAAAGGGGG - Intergenic
947748825 2:232522625-232522647 AGTCCCCAGGCCCCCAAGGCTGG + Intronic
948171363 2:235906169-235906191 GGTGCCCGGCCACCCGAGGCTGG - Intronic
1169299564 20:4430509-4430531 TGTGCCCAGCCAGCCCAGGCTGG - Intergenic
1170586871 20:17741394-17741416 GGTGCTTAGACACCCAAGGGTGG - Intergenic
1171426073 20:25049547-25049569 AGTGACCAAACACACAAGGCCGG + Intronic
1173608718 20:44351051-44351073 GGTTCTCAGAGAACCAAGGCTGG + Exonic
1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG + Intergenic
1175819085 20:61898842-61898864 GGTGCCCAGACCCCCATCCCAGG + Intronic
1178246696 21:30960079-30960101 GTTGCCCAAAGACACAAGGCAGG + Intergenic
1180074562 21:45456065-45456087 GGCGCCCACACAACCGAGGCTGG + Exonic
1180953665 22:19731776-19731798 GGAGGCCAGACACCCAAGCAAGG - Intergenic
1181017923 22:20081710-20081732 GGTGGCCAGAAACACCAGGCTGG - Intronic
1181107031 22:20581642-20581664 GGAGGCCAGACGCCCAGGGCTGG + Intronic
1181234242 22:21440318-21440340 GGTCCCCAGACACTGAGGGCAGG - Intronic
1181498290 22:23300725-23300747 GGTGCCCACATAACCCAGGCTGG + Intronic
1181830887 22:25559326-25559348 GATCCACAGACAGCCAAGGCAGG - Intergenic
1182067693 22:27442304-27442326 GGAGCCCAGAAACCCTGGGCAGG + Intergenic
1182116449 22:27759265-27759287 TGTGCACAGGCAGCCAAGGCAGG - Intronic
1182522638 22:30892961-30892983 GGTGGCCATGGACCCAAGGCAGG - Intronic
1183316407 22:37139321-37139343 CATGCCCCGCCACCCAAGGCAGG + Intronic
1184837296 22:47031578-47031600 GGTGCCCAGAGATGCAAGGGTGG + Intronic
1184864466 22:47194629-47194651 GCTGTCCAGATCCCCAAGGCGGG + Intergenic
1185240030 22:49737391-49737413 GGTGCCTGGACAGCCAAGGAAGG - Intergenic
951491586 3:23275456-23275478 GGTGGCCAGAAACACAATGCAGG - Intronic
953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG + Intronic
953883708 3:46704288-46704310 TGTCCCTAGACACCCAGGGCAGG + Intronic
953883716 3:46704315-46704337 TGTCCCTAGACACCCAGGGCAGG + Intronic
953883745 3:46704423-46704445 GTCGCCTAGACACCCAGGGCAGG + Intronic
954212955 3:49108601-49108623 GGAGCCCTGGCACCCAAGGGAGG + Intronic
954645748 3:52130624-52130646 GGTGCCCGACCACCCAAGCCAGG + Intronic
955484100 3:59418177-59418199 GGTGACCACTGACCCAAGGCTGG - Intergenic
956206732 3:66762639-66762661 GGTTGCCAGACAACCAAGGAGGG - Intergenic
961514259 3:127423006-127423028 TGGGCCCAGACGCCCGAGGCTGG + Intergenic
961514266 3:127423026-127423048 TGGGCCCAGACGCCCAAGGCTGG + Intergenic
962100775 3:132339878-132339900 GGTCACCAGAAAGCCAAGGCCGG - Intronic
962986335 3:140539610-140539632 GGTGCCAAGAAACCCCAGGATGG - Intronic
965413164 3:168357533-168357555 GGTGCCCTAAAACCCAAGCCAGG - Intergenic
966329241 3:178792880-178792902 GGTGCTGTGACACCCAATGCAGG - Intronic
966712157 3:182981219-182981241 GGTGCACTGAGACCCAAGGCCGG + Intronic
966910234 3:184555533-184555555 GCTGCCCAGAGACACAGGGCAGG + Intronic
967328645 3:188267863-188267885 GGTTGCCAGACACGCAAGCCCGG - Intronic
968005235 3:195238155-195238177 GCTGCCCAGTCACACGAGGCGGG - Intronic
968707549 4:2087411-2087433 GGTGGCCAGATACACAAGGCTGG + Intronic
969034363 4:4241045-4241067 GTTGCCCAGGCACTCCAGGCTGG - Intronic
969457049 4:7306197-7306219 GGGGCACAGACACCTAAGCCCGG + Intronic
969518750 4:7663682-7663704 GCTGCCGGGTCACCCAAGGCTGG + Intronic
970450578 4:16163092-16163114 GCTTCCCAGACAGTCAAGGCCGG + Exonic
973638797 4:52883945-52883967 GGTCTCCAGACACCCAACGGAGG - Intronic
975680133 4:76868052-76868074 GGTGCGCAGACTCCACAGGCAGG + Intergenic
976884998 4:89971198-89971220 GTTGCCCAGAAACATAAGGCTGG - Intergenic
985254411 4:188055533-188055555 GGTGGGCAGATACCCAAGGTCGG + Intergenic
997260650 5:132463288-132463310 GGTGCCCTGGCTCCCAAGCCAGG - Exonic
997863560 5:137441632-137441654 GGGTCCCAGTCACACAAGGCTGG + Intronic
997986109 5:138502732-138502754 TGTGCCCAGCCTCCCCAGGCTGG - Intergenic
998483901 5:142485371-142485393 GGTGTCCAGGCCTCCAAGGCTGG - Intergenic
998555395 5:143118378-143118400 TCTGCCCAGACACCCAGAGCTGG + Intronic
999480815 5:151946762-151946784 GGTGAGCAGCCACCCCAGGCTGG + Intergenic
999626999 5:153531353-153531375 CGGGCCCAGCCAACCAAGGCAGG + Intronic
1003441361 6:6145708-6145730 GATGCCCAGAGACCCAGGGCCGG + Exonic
1008208629 6:48694022-48694044 AGTGTCCAGGCACCCCAGGCAGG - Intergenic
1013186830 6:107766708-107766730 AGTGCCCATGCACCCAGGGCTGG - Intronic
1013281238 6:108639015-108639037 GGAGCCCAGCCTCCCAAGGACGG - Intronic
1017167464 6:151423181-151423203 TGTGCCCAGTCACACAAGGCTGG + Intronic
1019163125 6:170082082-170082104 TGTGCCCAGACACCCCTGGTTGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019433560 7:1010652-1010674 GGGGCCAAGACCCCCAAGGGAGG + Intronic
1020860736 7:13489277-13489299 GGTGTCCAGACTCCACAGGCAGG + Intergenic
1021224917 7:18015315-18015337 AATGCCCAGACACCCGAGGCTGG + Intergenic
1023670454 7:42570871-42570893 GGTGACCAGAGACCCACGGAGGG + Intergenic
1023835870 7:44066780-44066802 GCTGCCAGGACCCCCAAGGCTGG + Intronic
1024000161 7:45184547-45184569 GGTCCCCAGAAAACCCAGGCAGG - Intronic
1026382963 7:69817727-69817749 GCTGTCCCGCCACCCAAGGCAGG - Intronic
1026928124 7:74207764-74207786 GGTGATGAGACCCCCAAGGCTGG - Intronic
1026966362 7:74442586-74442608 AGTGCCCAGCCAGCCCAGGCTGG - Intergenic
1028574053 7:92326543-92326565 GGTACCCAGAATCCCAAGTCTGG + Intronic
1029592607 7:101517261-101517283 GGTTCCTAGACACCCAACGGAGG - Intronic
1030091676 7:105863635-105863657 GCTGCCCTGAACCCCAAGGCAGG - Intronic
1033809983 7:145001494-145001516 AGTGCCCACACACCCAACGTAGG - Intergenic
1035297702 7:157876569-157876591 GATGCACAGACGGCCAAGGCAGG + Intronic
1035321510 7:158032510-158032532 GATGCCAAGAGACCCAAGGCAGG + Intronic
1037390352 8:18386563-18386585 GGTGCCCATACACCCCACCCCGG + Intergenic
1037824296 8:22151796-22151818 CGTGGACTGACACCCAAGGCAGG + Intronic
1041794613 8:61733732-61733754 GGTGGCCAGAGAGCCACGGCTGG - Intergenic
1042858253 8:73288843-73288865 GGTGCCCAGACCCCTAAGGTTGG + Intergenic
1049334975 8:142079462-142079484 GGTGTCCAGACACCGAGGTCTGG - Intergenic
1049621760 8:143601443-143601465 GGGGCACAGGCCCCCAAGGCGGG + Exonic
1052282082 9:26744831-26744853 GGTCTCCTGACTCCCAAGGCTGG - Intergenic
1053416282 9:37948813-37948835 GGTGCTGAGTCTCCCAAGGCAGG - Intronic
1054356846 9:64070649-64070671 GGTGCCTGGGCACCCAAGTCAGG + Intergenic
1056758787 9:89399966-89399988 GTTGCCCAGGCACACGAGGCTGG - Intronic
1056959152 9:91106328-91106350 AGAGCCCAGCCACCTAAGGCAGG - Intergenic
1057039162 9:91834972-91834994 TGTGCCCAGAGACATAAGGCAGG - Intronic
1057958560 9:99432989-99433011 GGTGCCCAGTCACCCAACCCAGG + Intergenic
1060505657 9:124196811-124196833 GGGTCCCAGAGATCCAAGGCTGG + Intergenic
1061506340 9:131033911-131033933 GGAGCTCACACACCCAAAGCAGG - Intronic
1062401800 9:136376085-136376107 GGAGCCCAGACCCCAAAGGCAGG + Intronic
1186509085 X:10117180-10117202 GGAGGCCAGAGACCCACGGCTGG - Exonic
1190333454 X:49249371-49249393 GGTGCACTGATACCCAGGGCTGG + Intronic
1190748078 X:53338340-53338362 GGTCCCCAAAAAACCAAGGCAGG - Intergenic
1190798754 X:53769545-53769567 GGTCCCCAAAAAACCAAGGCAGG - Intergenic
1191080586 X:56505799-56505821 GGTGCACAGACTCCACAGGCAGG + Intergenic
1194746769 X:97636761-97636783 TGTGCCCAGACACACTGGGCAGG + Intergenic
1196819845 X:119693517-119693539 AGTCCCCAGACCCCGAAGGCTGG + Intergenic