ID: 936285894

View in Genome Browser
Species Human (GRCh38)
Location 2:111181135-111181157
Sequence GTGTTTGCACGAGTGTGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936285888_936285894 9 Left 936285888 2:111181103-111181125 CCATTCTCCCATGGCATTCTCTC No data
Right 936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG No data
936285887_936285894 12 Left 936285887 2:111181100-111181122 CCTCCATTCTCCCATGGCATTCT No data
Right 936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG No data
936285891_936285894 1 Left 936285891 2:111181111-111181133 CCATGGCATTCTCTCCTGTGGCG No data
Right 936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG No data
936285885_936285894 22 Left 936285885 2:111181090-111181112 CCAATCTCTTCCTCCATTCTCCC No data
Right 936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG No data
936285890_936285894 2 Left 936285890 2:111181110-111181132 CCCATGGCATTCTCTCCTGTGGC No data
Right 936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936285894 Original CRISPR GTGTTTGCACGAGTGTGTAT GGG Intergenic
No off target data available for this crispr