ID: 936286227

View in Genome Browser
Species Human (GRCh38)
Location 2:111183410-111183432
Sequence TGCCATTCCTGTAAAGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936286218_936286227 26 Left 936286218 2:111183361-111183383 CCAAACTAGCACATTCAGAGCAG No data
Right 936286227 2:111183410-111183432 TGCCATTCCTGTAAAGGGCACGG No data
936286221_936286227 -9 Left 936286221 2:111183396-111183418 CCCAACTCCACCTTTGCCATTCC No data
Right 936286227 2:111183410-111183432 TGCCATTCCTGTAAAGGGCACGG No data
936286220_936286227 -6 Left 936286220 2:111183393-111183415 CCTCCCAACTCCACCTTTGCCAT No data
Right 936286227 2:111183410-111183432 TGCCATTCCTGTAAAGGGCACGG No data
936286222_936286227 -10 Left 936286222 2:111183397-111183419 CCAACTCCACCTTTGCCATTCCT No data
Right 936286227 2:111183410-111183432 TGCCATTCCTGTAAAGGGCACGG No data
936286219_936286227 -2 Left 936286219 2:111183389-111183411 CCATCCTCCCAACTCCACCTTTG No data
Right 936286227 2:111183410-111183432 TGCCATTCCTGTAAAGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936286227 Original CRISPR TGCCATTCCTGTAAAGGGCA CGG Intergenic
No off target data available for this crispr