ID: 936289595

View in Genome Browser
Species Human (GRCh38)
Location 2:111211309-111211331
Sequence CCTGGGATGCAGAGGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936289595_936289604 25 Left 936289595 2:111211309-111211331 CCCTGCAACCTCTGCATCCCAGG No data
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113
936289595_936289601 16 Left 936289595 2:111211309-111211331 CCCTGCAACCTCTGCATCCCAGG No data
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711
936289595_936289602 17 Left 936289595 2:111211309-111211331 CCCTGCAACCTCTGCATCCCAGG No data
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936289595 Original CRISPR CCTGGGATGCAGAGGTTGCA GGG (reversed) Intergenic
No off target data available for this crispr