ID: 936289598

View in Genome Browser
Species Human (GRCh38)
Location 2:111211317-111211339
Sequence CACTTGAACCTGGGATGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234936
Summary {0: 44, 1: 9225, 2: 32964, 3: 76804, 4: 115899}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936289598_936289601 8 Left 936289598 2:111211317-111211339 CCTCTGCATCCCAGGTTCAAGTG 0: 44
1: 9225
2: 32964
3: 76804
4: 115899
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711
936289598_936289604 17 Left 936289598 2:111211317-111211339 CCTCTGCATCCCAGGTTCAAGTG 0: 44
1: 9225
2: 32964
3: 76804
4: 115899
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113
936289598_936289607 23 Left 936289598 2:111211317-111211339 CCTCTGCATCCCAGGTTCAAGTG 0: 44
1: 9225
2: 32964
3: 76804
4: 115899
Right 936289607 2:111211363-111211385 GTAGCTGGGATTATAGGTACAGG No data
936289598_936289602 9 Left 936289598 2:111211317-111211339 CCTCTGCATCCCAGGTTCAAGTG 0: 44
1: 9225
2: 32964
3: 76804
4: 115899
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936289598 Original CRISPR CACTTGAACCTGGGATGCAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr