ID: 936289599

View in Genome Browser
Species Human (GRCh38)
Location 2:111211326-111211348
Sequence CACAACAATCACTTGAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154708
Summary {0: 10, 1: 908, 2: 5860, 3: 38579, 4: 109351}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936289599_936289604 8 Left 936289599 2:111211326-111211348 CCCAGGTTCAAGTGATTGTTGTG 0: 10
1: 908
2: 5860
3: 38579
4: 109351
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113
936289599_936289607 14 Left 936289599 2:111211326-111211348 CCCAGGTTCAAGTGATTGTTGTG 0: 10
1: 908
2: 5860
3: 38579
4: 109351
Right 936289607 2:111211363-111211385 GTAGCTGGGATTATAGGTACAGG No data
936289599_936289602 0 Left 936289599 2:111211326-111211348 CCCAGGTTCAAGTGATTGTTGTG 0: 10
1: 908
2: 5860
3: 38579
4: 109351
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968
936289599_936289601 -1 Left 936289599 2:111211326-111211348 CCCAGGTTCAAGTGATTGTTGTG 0: 10
1: 908
2: 5860
3: 38579
4: 109351
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936289599 Original CRISPR CACAACAATCACTTGAACCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr