ID: 936289600

View in Genome Browser
Species Human (GRCh38)
Location 2:111211327-111211349
Sequence ACACAACAATCACTTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936289600_936289601 -2 Left 936289600 2:111211327-111211349 CCAGGTTCAAGTGATTGTTGTGT No data
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711
936289600_936289607 13 Left 936289600 2:111211327-111211349 CCAGGTTCAAGTGATTGTTGTGT No data
Right 936289607 2:111211363-111211385 GTAGCTGGGATTATAGGTACAGG No data
936289600_936289602 -1 Left 936289600 2:111211327-111211349 CCAGGTTCAAGTGATTGTTGTGT No data
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968
936289600_936289604 7 Left 936289600 2:111211327-111211349 CCAGGTTCAAGTGATTGTTGTGT No data
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936289600 Original CRISPR ACACAACAATCACTTGAACC TGG (reversed) Intergenic
No off target data available for this crispr