ID: 936289601

View in Genome Browser
Species Human (GRCh38)
Location 2:111211348-111211370
Sequence GTCTCAGCCTCCCAAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 775109
Summary {0: 4912, 1: 94001, 2: 203927, 3: 240558, 4: 231711}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936289595_936289601 16 Left 936289595 2:111211309-111211331 CCCTGCAACCTCTGCATCCCAGG No data
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711
936289599_936289601 -1 Left 936289599 2:111211326-111211348 CCCAGGTTCAAGTGATTGTTGTG 0: 10
1: 908
2: 5860
3: 38579
4: 109351
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711
936289598_936289601 8 Left 936289598 2:111211317-111211339 CCTCTGCATCCCAGGTTCAAGTG 0: 44
1: 9225
2: 32964
3: 76804
4: 115899
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711
936289600_936289601 -2 Left 936289600 2:111211327-111211349 CCAGGTTCAAGTGATTGTTGTGT No data
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711
936289597_936289601 15 Left 936289597 2:111211310-111211332 CCTGCAACCTCTGCATCCCAGGT No data
Right 936289601 2:111211348-111211370 GTCTCAGCCTCCCAAGTAGCTGG 0: 4912
1: 94001
2: 203927
3: 240558
4: 231711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936289601 Original CRISPR GTCTCAGCCTCCCAAGTAGC TGG Intergenic
Too many off-targets to display for this crispr