ID: 936289602

View in Genome Browser
Species Human (GRCh38)
Location 2:111211349-111211371
Sequence TCTCAGCCTCCCAAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 850086
Summary {0: 6552, 1: 107713, 2: 216650, 3: 253203, 4: 265968}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936289599_936289602 0 Left 936289599 2:111211326-111211348 CCCAGGTTCAAGTGATTGTTGTG 0: 10
1: 908
2: 5860
3: 38579
4: 109351
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968
936289598_936289602 9 Left 936289598 2:111211317-111211339 CCTCTGCATCCCAGGTTCAAGTG 0: 44
1: 9225
2: 32964
3: 76804
4: 115899
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968
936289595_936289602 17 Left 936289595 2:111211309-111211331 CCCTGCAACCTCTGCATCCCAGG No data
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968
936289597_936289602 16 Left 936289597 2:111211310-111211332 CCTGCAACCTCTGCATCCCAGGT No data
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968
936289600_936289602 -1 Left 936289600 2:111211327-111211349 CCAGGTTCAAGTGATTGTTGTGT No data
Right 936289602 2:111211349-111211371 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936289602 Original CRISPR TCTCAGCCTCCCAAGTAGCT GGG Intergenic
Too many off-targets to display for this crispr