ID: 936289604

View in Genome Browser
Species Human (GRCh38)
Location 2:111211357-111211379
Sequence TCCCAAGTAGCTGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1049574
Summary {0: 4641, 1: 61410, 2: 158925, 3: 280485, 4: 544113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936289595_936289604 25 Left 936289595 2:111211309-111211331 CCCTGCAACCTCTGCATCCCAGG No data
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113
936289598_936289604 17 Left 936289598 2:111211317-111211339 CCTCTGCATCCCAGGTTCAAGTG 0: 44
1: 9225
2: 32964
3: 76804
4: 115899
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113
936289597_936289604 24 Left 936289597 2:111211310-111211332 CCTGCAACCTCTGCATCCCAGGT No data
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113
936289600_936289604 7 Left 936289600 2:111211327-111211349 CCAGGTTCAAGTGATTGTTGTGT No data
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113
936289599_936289604 8 Left 936289599 2:111211326-111211348 CCCAGGTTCAAGTGATTGTTGTG 0: 10
1: 908
2: 5860
3: 38579
4: 109351
Right 936289604 2:111211357-111211379 TCCCAAGTAGCTGGGATTATAGG 0: 4641
1: 61410
2: 158925
3: 280485
4: 544113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936289604 Original CRISPR TCCCAAGTAGCTGGGATTAT AGG Intergenic
Too many off-targets to display for this crispr