ID: 936293582

View in Genome Browser
Species Human (GRCh38)
Location 2:111247910-111247932
Sequence CGCTTCAGTGTTTGCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936293577_936293582 8 Left 936293577 2:111247879-111247901 CCCACCGCTCTTGAAAGATATTA No data
Right 936293582 2:111247910-111247932 CGCTTCAGTGTTTGCTCCTGGGG No data
936293576_936293582 13 Left 936293576 2:111247874-111247896 CCACACCCACCGCTCTTGAAAGA No data
Right 936293582 2:111247910-111247932 CGCTTCAGTGTTTGCTCCTGGGG No data
936293575_936293582 23 Left 936293575 2:111247864-111247886 CCTGCTGGAACCACACCCACCGC No data
Right 936293582 2:111247910-111247932 CGCTTCAGTGTTTGCTCCTGGGG No data
936293579_936293582 4 Left 936293579 2:111247883-111247905 CCGCTCTTGAAAGATATTACTGT No data
Right 936293582 2:111247910-111247932 CGCTTCAGTGTTTGCTCCTGGGG No data
936293578_936293582 7 Left 936293578 2:111247880-111247902 CCACCGCTCTTGAAAGATATTAC No data
Right 936293582 2:111247910-111247932 CGCTTCAGTGTTTGCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936293582 Original CRISPR CGCTTCAGTGTTTGCTCCTG GGG Intergenic
No off target data available for this crispr