ID: 936298342

View in Genome Browser
Species Human (GRCh38)
Location 2:111285152-111285174
Sequence ATGAATAGACATATTGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936298339_936298342 3 Left 936298339 2:111285126-111285148 CCCTCAGTACGGCTTCCAGGATA No data
Right 936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG No data
936298336_936298342 28 Left 936298336 2:111285101-111285123 CCTATTTCTTTTGCTTGTTTCAT No data
Right 936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG No data
936298340_936298342 2 Left 936298340 2:111285127-111285149 CCTCAGTACGGCTTCCAGGATAC No data
Right 936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936298342 Original CRISPR ATGAATAGACATATTGACAA TGG Intergenic
No off target data available for this crispr