ID: 936300819

View in Genome Browser
Species Human (GRCh38)
Location 2:111303571-111303593
Sequence CTGTAGAGAGAGAGGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936300819_936300825 1 Left 936300819 2:111303571-111303593 CCCCAGAGCCTCTCTCTCTACAG No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300819_936300829 26 Left 936300819 2:111303571-111303593 CCCCAGAGCCTCTCTCTCTACAG No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300819_936300827 18 Left 936300819 2:111303571-111303593 CCCCAGAGCCTCTCTCTCTACAG No data
Right 936300827 2:111303612-111303634 TTGAGGACCTGTCTCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936300819 Original CRISPR CTGTAGAGAGAGAGGCTCTG GGG (reversed) Intergenic
No off target data available for this crispr