ID: 936300820

View in Genome Browser
Species Human (GRCh38)
Location 2:111303572-111303594
Sequence CCTGTAGAGAGAGAGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936300820_936300829 25 Left 936300820 2:111303572-111303594 CCCAGAGCCTCTCTCTCTACAGG No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300820_936300825 0 Left 936300820 2:111303572-111303594 CCCAGAGCCTCTCTCTCTACAGG No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300820_936300827 17 Left 936300820 2:111303572-111303594 CCCAGAGCCTCTCTCTCTACAGG No data
Right 936300827 2:111303612-111303634 TTGAGGACCTGTCTCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936300820 Original CRISPR CCTGTAGAGAGAGAGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr