ID: 936300822

View in Genome Browser
Species Human (GRCh38)
Location 2:111303573-111303595
Sequence ACCTGTAGAGAGAGAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936300822_936300825 -1 Left 936300822 2:111303573-111303595 CCAGAGCCTCTCTCTCTACAGGT No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300822_936300829 24 Left 936300822 2:111303573-111303595 CCAGAGCCTCTCTCTCTACAGGT No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300822_936300827 16 Left 936300822 2:111303573-111303595 CCAGAGCCTCTCTCTCTACAGGT No data
Right 936300827 2:111303612-111303634 TTGAGGACCTGTCTCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936300822 Original CRISPR ACCTGTAGAGAGAGAGGCTC TGG (reversed) Intergenic
No off target data available for this crispr