ID: 936300825

View in Genome Browser
Species Human (GRCh38)
Location 2:111303595-111303617
Sequence TTTGCCTGGCTCTTAATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936300820_936300825 0 Left 936300820 2:111303572-111303594 CCCAGAGCCTCTCTCTCTACAGG No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300822_936300825 -1 Left 936300822 2:111303573-111303595 CCAGAGCCTCTCTCTCTACAGGT No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300814_936300825 19 Left 936300814 2:111303553-111303575 CCACTCCTCCCAGTCTACCCCCA No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300819_936300825 1 Left 936300819 2:111303571-111303593 CCCCAGAGCCTCTCTCTCTACAG No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300823_936300825 -7 Left 936300823 2:111303579-111303601 CCTCTCTCTCTACAGGTTTGCCT No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300815_936300825 14 Left 936300815 2:111303558-111303580 CCTCCCAGTCTACCCCCAGAGCC No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300816_936300825 11 Left 936300816 2:111303561-111303583 CCCAGTCTACCCCCAGAGCCTCT No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300818_936300825 2 Left 936300818 2:111303570-111303592 CCCCCAGAGCCTCTCTCTCTACA No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300813_936300825 26 Left 936300813 2:111303546-111303568 CCATCTTCCACTCCTCCCAGTCT No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data
936300817_936300825 10 Left 936300817 2:111303562-111303584 CCAGTCTACCCCCAGAGCCTCTC No data
Right 936300825 2:111303595-111303617 TTTGCCTGGCTCTTAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936300825 Original CRISPR TTTGCCTGGCTCTTAATTTG AGG Intergenic
No off target data available for this crispr