ID: 936300826

View in Genome Browser
Species Human (GRCh38)
Location 2:111303599-111303621
Sequence AGGTCCTCAAATTAAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936300826_936300829 -2 Left 936300826 2:111303599-111303621 CCTGGCTCTTAATTTGAGGACCT No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300826_936300827 -10 Left 936300826 2:111303599-111303621 CCTGGCTCTTAATTTGAGGACCT No data
Right 936300827 2:111303612-111303634 TTGAGGACCTGTCTCTGCAGAGG No data
936300826_936300831 12 Left 936300826 2:111303599-111303621 CCTGGCTCTTAATTTGAGGACCT No data
Right 936300831 2:111303634-111303656 GCCCCTTGGTGATAAACTCAGGG No data
936300826_936300830 11 Left 936300826 2:111303599-111303621 CCTGGCTCTTAATTTGAGGACCT No data
Right 936300830 2:111303633-111303655 GGCCCCTTGGTGATAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936300826 Original CRISPR AGGTCCTCAAATTAAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr