ID: 936300829

View in Genome Browser
Species Human (GRCh38)
Location 2:111303620-111303642
Sequence CTGTCTCTGCAGAGGCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936300820_936300829 25 Left 936300820 2:111303572-111303594 CCCAGAGCCTCTCTCTCTACAGG No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300823_936300829 18 Left 936300823 2:111303579-111303601 CCTCTCTCTCTACAGGTTTGCCT No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300818_936300829 27 Left 936300818 2:111303570-111303592 CCCCCAGAGCCTCTCTCTCTACA No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300826_936300829 -2 Left 936300826 2:111303599-111303621 CCTGGCTCTTAATTTGAGGACCT No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300819_936300829 26 Left 936300819 2:111303571-111303593 CCCCAGAGCCTCTCTCTCTACAG No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data
936300822_936300829 24 Left 936300822 2:111303573-111303595 CCAGAGCCTCTCTCTCTACAGGT No data
Right 936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936300829 Original CRISPR CTGTCTCTGCAGAGGCCCCT TGG Intergenic
No off target data available for this crispr