ID: 936301570

View in Genome Browser
Species Human (GRCh38)
Location 2:111308438-111308460
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936301565_936301570 13 Left 936301565 2:111308402-111308424 CCTTAGATGAGCTTGGGCTGAGT No data
Right 936301570 2:111308438-111308460 CCCCACCGGGACCCCTGTGAAGG No data
936301561_936301570 20 Left 936301561 2:111308395-111308417 CCTTCCACCTTAGATGAGCTTGG No data
Right 936301570 2:111308438-111308460 CCCCACCGGGACCCCTGTGAAGG No data
936301564_936301570 16 Left 936301564 2:111308399-111308421 CCACCTTAGATGAGCTTGGGCTG No data
Right 936301570 2:111308438-111308460 CCCCACCGGGACCCCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr